FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640197_at:

>probe:Drosophila_2:1640197_at:610:657; Interrogation_Position=139; Antisense; TAAGTTTACGCGATGAGCTCCGCTT
>probe:Drosophila_2:1640197_at:667:485; Interrogation_Position=166; Antisense; GTAGACTCGGCTTACATCATCATTC
>probe:Drosophila_2:1640197_at:226:555; Interrogation_Position=197; Antisense; GGACTTCCTACGTTCGCAATGGCAG
>probe:Drosophila_2:1640197_at:261:89; Interrogation_Position=220; Antisense; AGTCTGGGCCGAAATCTTCTATTTT
>probe:Drosophila_2:1640197_at:54:701; Interrogation_Position=241; Antisense; TTTTCTTGGCTTACCGATGGGCATT
>probe:Drosophila_2:1640197_at:278:327; Interrogation_Position=367; Antisense; GCGTTACCAGTATTGCCGGAGCAAT
>probe:Drosophila_2:1640197_at:691:403; Interrogation_Position=398; Antisense; GACTATCTATCACTACAAGCCGGAA
>probe:Drosophila_2:1640197_at:633:269; Interrogation_Position=479; Antisense; CATCACATTGGCGTGCTTAATTGCA
>probe:Drosophila_2:1640197_at:522:247; Interrogation_Position=497; Antisense; AATTGCATTCGCCTATTGGACAGCC
>probe:Drosophila_2:1640197_at:75:191; Interrogation_Position=576; Antisense; AACATATGGACTCACTTGCTGCCAC
>probe:Drosophila_2:1640197_at:196:129; Interrogation_Position=599; Antisense; ACCTATTTTCTTCACCATCGATAAC
>probe:Drosophila_2:1640197_at:138:43; Interrogation_Position=615; Antisense; ATCGATAACTTTCTGGTGGCGCAAC
>probe:Drosophila_2:1640197_at:352:403; Interrogation_Position=646; Antisense; GACTTCTTCACTTTGTTTATCCACT
>probe:Drosophila_2:1640197_at:616:239; Interrogation_Position=701; Antisense; AATACTATTCTATGCCCTGGGCGGT

Paste this into a BLAST search page for me
TAAGTTTACGCGATGAGCTCCGCTTGTAGACTCGGCTTACATCATCATTCGGACTTCCTACGTTCGCAATGGCAGAGTCTGGGCCGAAATCTTCTATTTTTTTTCTTGGCTTACCGATGGGCATTGCGTTACCAGTATTGCCGGAGCAATGACTATCTATCACTACAAGCCGGAACATCACATTGGCGTGCTTAATTGCAAATTGCATTCGCCTATTGGACAGCCAACATATGGACTCACTTGCTGCCACACCTATTTTCTTCACCATCGATAACATCGATAACTTTCTGGTGGCGCAACGACTTCTTCACTTTGTTTATCCACTAATACTATTCTATGCCCTGGGCGGT

Full Affymetrix probeset data:

Annotations for 1640197_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720