FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640198_at:

>probe:Drosophila_2:1640198_at:76:79; Interrogation_Position=2028; Antisense; AGGTACACACCTGGAAGGAGCGCAT
>probe:Drosophila_2:1640198_at:27:555; Interrogation_Position=2044; Antisense; GGAGCGCATGAGCACCAAAGTAATT
>probe:Drosophila_2:1640198_at:151:181; Interrogation_Position=2079; Antisense; AAAAGGTGAACCTGCCGGTGGCCAG
>probe:Drosophila_2:1640198_at:259:681; Interrogation_Position=2110; Antisense; TATGGCCAAGATGTGTGTGCGCTAT
>probe:Drosophila_2:1640198_at:84:427; Interrogation_Position=2155; Antisense; GAGAGTTTTGCGACAACTCCTTCAA
>probe:Drosophila_2:1640198_at:471:439; Interrogation_Position=2201; Antisense; GATGTGTCGGACTGGTTAACCTATC
>probe:Drosophila_2:1640198_at:263:203; Interrogation_Position=2218; Antisense; AACCTATCTGAACAACTTTCTGAGC
>probe:Drosophila_2:1640198_at:651:117; Interrogation_Position=2240; Antisense; AGCTATGAAGAGTCCATGTCTCCAG
>probe:Drosophila_2:1640198_at:465:61; Interrogation_Position=2255; Antisense; ATGTCTCCAGTAGACTCTGCGTCTT
>probe:Drosophila_2:1640198_at:204:261; Interrogation_Position=2274; Antisense; CGTCTTCCTCCTTATTGGGAGGCAT
>probe:Drosophila_2:1640198_at:159:233; Interrogation_Position=2423; Antisense; AATGCATTTGATTCGTTACCGTTTG
>probe:Drosophila_2:1640198_at:197:303; Interrogation_Position=2441; Antisense; CCGTTTGTCATAAATTCCGTTTCTG
>probe:Drosophila_2:1640198_at:28:305; Interrogation_Position=2457; Antisense; CCGTTTCTGTATTTCTCCATTGCAA
>probe:Drosophila_2:1640198_at:40:157; Interrogation_Position=2537; Antisense; ACAGCTACTGCGCATGTACATACAT

Paste this into a BLAST search page for me
AGGTACACACCTGGAAGGAGCGCATGGAGCGCATGAGCACCAAAGTAATTAAAAGGTGAACCTGCCGGTGGCCAGTATGGCCAAGATGTGTGTGCGCTATGAGAGTTTTGCGACAACTCCTTCAAGATGTGTCGGACTGGTTAACCTATCAACCTATCTGAACAACTTTCTGAGCAGCTATGAAGAGTCCATGTCTCCAGATGTCTCCAGTAGACTCTGCGTCTTCGTCTTCCTCCTTATTGGGAGGCATAATGCATTTGATTCGTTACCGTTTGCCGTTTGTCATAAATTCCGTTTCTGCCGTTTCTGTATTTCTCCATTGCAAACAGCTACTGCGCATGTACATACAT

Full Affymetrix probeset data:

Annotations for 1640198_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720