FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640199_at:

>probe:Drosophila_2:1640199_at:181:489; Interrogation_Position=3420; Antisense; GTACTATAGAAATTGTGCAGCCCGA
>probe:Drosophila_2:1640199_at:300:597; Interrogation_Position=3433; Antisense; TGTGCAGCCCGATGGAAACAGCTTT
>probe:Drosophila_2:1640199_at:650:221; Interrogation_Position=3467; Antisense; AAGGGATTGATTATACCCAAGTATC
>probe:Drosophila_2:1640199_at:275:511; Interrogation_Position=3512; Antisense; GTGAAAACTCATATTATTCCCCGAA
>probe:Drosophila_2:1640199_at:534:1; Interrogation_Position=3549; Antisense; ATTGGCCCTTAAGCAACTTGTACTT
>probe:Drosophila_2:1640199_at:409:533; Interrogation_Position=3637; Antisense; GGTGATTCTTCTTAAGTGGCTTTAC
>probe:Drosophila_2:1640199_at:269:399; Interrogation_Position=3748; Antisense; GACAGGTACATTTGTTTGTTCCCTA
>probe:Drosophila_2:1640199_at:544:691; Interrogation_Position=3762; Antisense; TTTGTTCCCTATAAACCAGTGTTTG
>probe:Drosophila_2:1640199_at:666:215; Interrogation_Position=3800; Antisense; AAGATAATCGCGTTTGTTACCATTG
>probe:Drosophila_2:1640199_at:207:603; Interrogation_Position=3814; Antisense; TGTTACCATTGTTATCGCCATCGAT
>probe:Drosophila_2:1640199_at:271:43; Interrogation_Position=3833; Antisense; ATCGATTCCTCTGCATACGGGTGTT
>probe:Drosophila_2:1640199_at:525:11; Interrogation_Position=3885; Antisense; ATTCGATCATTGCTGACCTTAGACC
>probe:Drosophila_2:1640199_at:533:103; Interrogation_Position=3905; Antisense; AGACCACTGAGATTAACTGCCGCAC
>probe:Drosophila_2:1640199_at:541:283; Interrogation_Position=3921; Antisense; CTGCCGCACAGGTCTTATCTTAAAT

Paste this into a BLAST search page for me
GTACTATAGAAATTGTGCAGCCCGATGTGCAGCCCGATGGAAACAGCTTTAAGGGATTGATTATACCCAAGTATCGTGAAAACTCATATTATTCCCCGAAATTGGCCCTTAAGCAACTTGTACTTGGTGATTCTTCTTAAGTGGCTTTACGACAGGTACATTTGTTTGTTCCCTATTTGTTCCCTATAAACCAGTGTTTGAAGATAATCGCGTTTGTTACCATTGTGTTACCATTGTTATCGCCATCGATATCGATTCCTCTGCATACGGGTGTTATTCGATCATTGCTGACCTTAGACCAGACCACTGAGATTAACTGCCGCACCTGCCGCACAGGTCTTATCTTAAAT

Full Affymetrix probeset data:

Annotations for 1640199_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720