Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640200_at:

>probe:Drosophila_2:1640200_at:250:491; Interrogation_Position=10031; Antisense; GTAAATTTCGAAACATGCAATCAGT
>probe:Drosophila_2:1640200_at:136:485; Interrogation_Position=10064; Antisense; GTATCCTTATTTATTCCGATTTCTT
>probe:Drosophila_2:1640200_at:200:305; Interrogation_Position=10079; Antisense; CCGATTTCTTGTGTATTATTTCTTA
>probe:Drosophila_2:1640200_at:712:39; Interrogation_Position=10122; Antisense; ATCTGTGCTAACTGAAAGTGTGCTG
>probe:Drosophila_2:1640200_at:8:221; Interrogation_Position=10137; Antisense; AAGTGTGCTGCAATGTTTTTAATTA
>probe:Drosophila_2:1640200_at:134:665; Interrogation_Position=9621; Antisense; TACACTATTGCGAAGAATCAGATGG
>probe:Drosophila_2:1640200_at:519:343; Interrogation_Position=9664; Antisense; GCTTCGAGTAAGCTGAGAACACTTT
>probe:Drosophila_2:1640200_at:126:679; Interrogation_Position=9793; Antisense; TAGATAAGCTGTAACTCCAACACAT
>probe:Drosophila_2:1640200_at:284:145; Interrogation_Position=9806; Antisense; ACTCCAACACATACTTACATCCAAT
>probe:Drosophila_2:1640200_at:61:191; Interrogation_Position=9867; Antisense; AACATATTCATAATTTCCTAGTACA
>probe:Drosophila_2:1640200_at:558:389; Interrogation_Position=9893; Antisense; GAAAAATTGTTATAACTCGCACCTT
>probe:Drosophila_2:1640200_at:217:145; Interrogation_Position=9907; Antisense; ACTCGCACCTTTTTCAAACAACTGA
>probe:Drosophila_2:1640200_at:670:373; Interrogation_Position=9961; Antisense; GAAGAACCAGCTAACAGTTTTTGGT
>probe:Drosophila_2:1640200_at:17:267; Interrogation_Position=9975; Antisense; CAGTTTTTGGTTAGCTTTCATATCA

Paste this into a BLAST search page for me
GTAAATTTCGAAACATGCAATCAGTGTATCCTTATTTATTCCGATTTCTTCCGATTTCTTGTGTATTATTTCTTAATCTGTGCTAACTGAAAGTGTGCTGAAGTGTGCTGCAATGTTTTTAATTATACACTATTGCGAAGAATCAGATGGGCTTCGAGTAAGCTGAGAACACTTTTAGATAAGCTGTAACTCCAACACATACTCCAACACATACTTACATCCAATAACATATTCATAATTTCCTAGTACAGAAAAATTGTTATAACTCGCACCTTACTCGCACCTTTTTCAAACAACTGAGAAGAACCAGCTAACAGTTTTTGGTCAGTTTTTGGTTAGCTTTCATATCA

Full Affymetrix probeset data:

Annotations for 1640200_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime