Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640201_at:

>probe:Drosophila_2:1640201_at:676:671; Interrogation_Position=400; Antisense; TACGAAGGCGAGTTTCATCAGGGCT
>probe:Drosophila_2:1640201_at:455:647; Interrogation_Position=414; Antisense; TCATCAGGGCTGGTTTCATGGTAAT
>probe:Drosophila_2:1640201_at:26:657; Interrogation_Position=435; Antisense; TAATGGGATCTTCTGGAGAGCCGAT
>probe:Drosophila_2:1640201_at:114:287; Interrogation_Position=505; Antisense; CTGGGATTGCTGACGTTCCAGGACT
>probe:Drosophila_2:1640201_at:610:135; Interrogation_Position=532; Antisense; ACGCACGGCTTTCCCAGAAACGAGG
>probe:Drosophila_2:1640201_at:241:433; Interrogation_Position=553; Antisense; GAGGGATTCTTTCAAGACTGCCGCT
>probe:Drosophila_2:1640201_at:650:103; Interrogation_Position=567; Antisense; AGACTGCCGCTTTATGAGACGACGT
>probe:Drosophila_2:1640201_at:722:605; Interrogation_Position=581; Antisense; TGAGACGACGTCGATGTCCCGAGGT
>probe:Drosophila_2:1640201_at:416:633; Interrogation_Position=597; Antisense; TCCCGAGGTGGTGCAGCGTGCACAA
>probe:Drosophila_2:1640201_at:522:159; Interrogation_Position=618; Antisense; ACAAAAGTGCGCTCTTATGGCCCGT
>probe:Drosophila_2:1640201_at:515:153; Interrogation_Position=667; Antisense; ACAGACACTTCAGATTGGTTACCAG
>probe:Drosophila_2:1640201_at:266:151; Interrogation_Position=828; Antisense; ACATTTGCGCATAAACGTTCGTAAA
>probe:Drosophila_2:1640201_at:373:615; Interrogation_Position=873; Antisense; TGCATACAATTTCGCGTTTACTTTA
>probe:Drosophila_2:1640201_at:307:31; Interrogation_Position=923; Antisense; ATCAAAAATTCTTCAACGCACCCTA

Paste this into a BLAST search page for me
TACGAAGGCGAGTTTCATCAGGGCTTCATCAGGGCTGGTTTCATGGTAATTAATGGGATCTTCTGGAGAGCCGATCTGGGATTGCTGACGTTCCAGGACTACGCACGGCTTTCCCAGAAACGAGGGAGGGATTCTTTCAAGACTGCCGCTAGACTGCCGCTTTATGAGACGACGTTGAGACGACGTCGATGTCCCGAGGTTCCCGAGGTGGTGCAGCGTGCACAAACAAAAGTGCGCTCTTATGGCCCGTACAGACACTTCAGATTGGTTACCAGACATTTGCGCATAAACGTTCGTAAATGCATACAATTTCGCGTTTACTTTAATCAAAAATTCTTCAACGCACCCTA

Full Affymetrix probeset data:

Annotations for 1640201_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime