FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640202_at:

>probe:Drosophila_2:1640202_at:290:225; Interrogation_Position=1006; Antisense; AAGGAGTTCCTGTTGTGCCGGAGAC
>probe:Drosophila_2:1640202_at:589:317; Interrogation_Position=1067; Antisense; GCCTGGATTACTAAGCTATGCTGAA
>probe:Drosophila_2:1640202_at:677:593; Interrogation_Position=1095; Antisense; TGCGGAAAGTTGTCCAATCCCCAAA
>probe:Drosophila_2:1640202_at:712:221; Interrogation_Position=1131; Antisense; AAGGGCAACGAATCGCCACTGCGAA
>probe:Drosophila_2:1640202_at:213:619; Interrogation_Position=1150; Antisense; TGCGAAGAGTTTCTGATCCCACCAA
>probe:Drosophila_2:1640202_at:174:439; Interrogation_Position=1183; Antisense; GAGGCATAGCTTATCGCCCAGTGGA
>probe:Drosophila_2:1640202_at:186:99; Interrogation_Position=1271; Antisense; AGCCTATGCCCGTGTCAAGAACCTA
>probe:Drosophila_2:1640202_at:407:329; Interrogation_Position=1300; Antisense; GCGTGGCGCTGTTCGATCTGAGCTA
>probe:Drosophila_2:1640202_at:288:419; Interrogation_Position=1319; Antisense; GAGCTACGATGATTTCCGTGGACAG
>probe:Drosophila_2:1640202_at:61:33; Interrogation_Position=1354; Antisense; ATAAGTATCCCATTCTGCGAGCCAT
>probe:Drosophila_2:1640202_at:94:543; Interrogation_Position=877; Antisense; GGTTGGCACACCTTAACGCTGATTT
>probe:Drosophila_2:1640202_at:163:489; Interrogation_Position=911; Antisense; GTACTGGCTATCTCAGGGATTCCCA
>probe:Drosophila_2:1640202_at:239:551; Interrogation_Position=954; Antisense; GGAGTTGCCACCTATGGTAATGCAT
>probe:Drosophila_2:1640202_at:560:1; Interrogation_Position=984; Antisense; CTTACCAAGGACTCGGGTCTCGAAG

Paste this into a BLAST search page for me
AAGGAGTTCCTGTTGTGCCGGAGACGCCTGGATTACTAAGCTATGCTGAATGCGGAAAGTTGTCCAATCCCCAAAAAGGGCAACGAATCGCCACTGCGAATGCGAAGAGTTTCTGATCCCACCAAGAGGCATAGCTTATCGCCCAGTGGAAGCCTATGCCCGTGTCAAGAACCTAGCGTGGCGCTGTTCGATCTGAGCTAGAGCTACGATGATTTCCGTGGACAGATAAGTATCCCATTCTGCGAGCCATGGTTGGCACACCTTAACGCTGATTTGTACTGGCTATCTCAGGGATTCCCAGGAGTTGCCACCTATGGTAATGCATCTTACCAAGGACTCGGGTCTCGAAG

Full Affymetrix probeset data:

Annotations for 1640202_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720