FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640203_at:

>probe:Drosophila_2:1640203_at:436:633; Interrogation_Position=109; Antisense; TCGCTGGGCCACCACCATGACAGGA
>probe:Drosophila_2:1640203_at:598:593; Interrogation_Position=113; Antisense; TGGGCCACCACCATGACAGGAGCAC
>probe:Drosophila_2:1640203_at:646:55; Interrogation_Position=125; Antisense; ATGACAGGAGCACCCTGTCCGACGG
>probe:Drosophila_2:1640203_at:210:75; Interrogation_Position=130; Antisense; AGGAGCACCCTGTCCGACGGCGACG
>probe:Drosophila_2:1640203_at:171:347; Interrogation_Position=134; Antisense; GCACCCTGTCCGACGGCGACGAGGA
>probe:Drosophila_2:1640203_at:456:611; Interrogation_Position=14; Antisense; TGAAAGCGACCAGGAACGGCGGCCA
>probe:Drosophila_2:1640203_at:171:77; Interrogation_Position=158; Antisense; AGGAGGGCGGCCTTGGCTACACCCA
>probe:Drosophila_2:1640203_at:18:207; Interrogation_Position=17; Antisense; AAGCGACCAGGAACGGCGGCCAGCT
>probe:Drosophila_2:1640203_at:59:135; Interrogation_Position=178; Antisense; ACCCACACGCTGAAACCATCGTATA
>probe:Drosophila_2:1640203_at:154:155; Interrogation_Position=182; Antisense; ACACGCTGAAACCATCGTATAGAGA
>probe:Drosophila_2:1640203_at:143:299; Interrogation_Position=185; Antisense; CGCTGAAACCATCGTATAGAGATTC
>probe:Drosophila_2:1640203_at:698:391; Interrogation_Position=189; Antisense; GAAACCATCGTATAGAGATTCAAAT
>probe:Drosophila_2:1640203_at:241:677; Interrogation_Position=201; Antisense; TAGAGATTCAAATGTCATTACCTGA
>probe:Drosophila_2:1640203_at:100:719; Interrogation_Position=54; Antisense; TTCGCCGCAGACTGCTGCCCGTCTG

Paste this into a BLAST search page for me
TCGCTGGGCCACCACCATGACAGGATGGGCCACCACCATGACAGGAGCACATGACAGGAGCACCCTGTCCGACGGAGGAGCACCCTGTCCGACGGCGACGGCACCCTGTCCGACGGCGACGAGGATGAAAGCGACCAGGAACGGCGGCCAAGGAGGGCGGCCTTGGCTACACCCAAAGCGACCAGGAACGGCGGCCAGCTACCCACACGCTGAAACCATCGTATAACACGCTGAAACCATCGTATAGAGACGCTGAAACCATCGTATAGAGATTCGAAACCATCGTATAGAGATTCAAATTAGAGATTCAAATGTCATTACCTGATTCGCCGCAGACTGCTGCCCGTCTG

Full Affymetrix probeset data:

Annotations for 1640203_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720