FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640204_at:

>probe:Drosophila_2:1640204_at:20:99; Interrogation_Position=4786; Antisense; AGAGAAGTCCGCACTATTACCTGGT
>probe:Drosophila_2:1640204_at:104:707; Interrogation_Position=4802; Antisense; TTACCTGGTGCCATTGAAACCGTAT
>probe:Drosophila_2:1640204_at:107:49; Interrogation_Position=4860; Antisense; ATCCATTGTCGGTTCATAGCACTGA
>probe:Drosophila_2:1640204_at:160:395; Interrogation_Position=4883; Antisense; GAAATTAGCTTCGATTACCACTTAG
>probe:Drosophila_2:1640204_at:600:611; Interrogation_Position=4976; Antisense; TGAACGTCGAACTATTTGGAATACT
>probe:Drosophila_2:1640204_at:500:563; Interrogation_Position=4993; Antisense; GGAATACTTATAAACGCCTAATTGT
>probe:Drosophila_2:1640204_at:213:457; Interrogation_Position=5098; Antisense; GATACTATAGCTAACTATCGCCGAA
>probe:Drosophila_2:1640204_at:570:633; Interrogation_Position=5115; Antisense; TCGCCGAATATATCGCAATTGTTAA
>probe:Drosophila_2:1640204_at:282:477; Interrogation_Position=5173; Antisense; GTTATTATTAATGAGCCCACGAGTA
>probe:Drosophila_2:1640204_at:210:417; Interrogation_Position=5185; Antisense; GAGCCCACGAGTAAATGCAACAGTA
>probe:Drosophila_2:1640204_at:455:187; Interrogation_Position=5203; Antisense; AACAGTAACCAATATCAAACGCCTA
>probe:Drosophila_2:1640204_at:298:253; Interrogation_Position=5218; Antisense; CAAACGCCTACAGACCGAAGCAAAA
>probe:Drosophila_2:1640204_at:530:177; Interrogation_Position=5240; Antisense; AAACTAAACACTATCGCAGCTCAAA
>probe:Drosophila_2:1640204_at:6:345; Interrogation_Position=5270; Antisense; GCATAGCTCAGCAAGGATATAACAA

Paste this into a BLAST search page for me
AGAGAAGTCCGCACTATTACCTGGTTTACCTGGTGCCATTGAAACCGTATATCCATTGTCGGTTCATAGCACTGAGAAATTAGCTTCGATTACCACTTAGTGAACGTCGAACTATTTGGAATACTGGAATACTTATAAACGCCTAATTGTGATACTATAGCTAACTATCGCCGAATCGCCGAATATATCGCAATTGTTAAGTTATTATTAATGAGCCCACGAGTAGAGCCCACGAGTAAATGCAACAGTAAACAGTAACCAATATCAAACGCCTACAAACGCCTACAGACCGAAGCAAAAAAACTAAACACTATCGCAGCTCAAAGCATAGCTCAGCAAGGATATAACAA

Full Affymetrix probeset data:

Annotations for 1640204_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720