FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640205_at:

>probe:Drosophila_2:1640205_at:338:721; Interrogation_Position=133; Antisense; TTGGGACGCTCATCGAAGGTGGATT
>probe:Drosophila_2:1640205_at:186:275; Interrogation_Position=199; Antisense; CTTGTGCCCACTGTGCTTGTGAAAA
>probe:Drosophila_2:1640205_at:728:569; Interrogation_Position=229; Antisense; GGCATAGTGCCCACTGTGTTGGTAA
>probe:Drosophila_2:1640205_at:641:255; Interrogation_Position=265; Antisense; CAAATCTTACCTGCCGTCAATGTTG
>probe:Drosophila_2:1640205_at:205:229; Interrogation_Position=283; Antisense; AATGTTGCCGCCGATGTGGAAACGC
>probe:Drosophila_2:1640205_at:498:581; Interrogation_Position=361; Antisense; TGGCCCGACTATGGATCCTATGGAT
>probe:Drosophila_2:1640205_at:132:681; Interrogation_Position=379; Antisense; TATGGATCCTATGGCTATCCCGGCG
>probe:Drosophila_2:1640205_at:23:193; Interrogation_Position=433; Antisense; AACTACTACGACTATGGAGCACCCT
>probe:Drosophila_2:1640205_at:395:625; Interrogation_Position=461; Antisense; TGCCCAGACGTCGTTTTGTTAAGCC
>probe:Drosophila_2:1640205_at:618:355; Interrogation_Position=545; Antisense; GCACTACTACCACTGTTTCTGGTGA
>probe:Drosophila_2:1640205_at:625:511; Interrogation_Position=566; Antisense; GTGAGGATTCGCCATCTGTGACTAC
>probe:Drosophila_2:1640205_at:49:595; Interrogation_Position=582; Antisense; TGTGACTACCGATGTCGTTCCCGAT
>probe:Drosophila_2:1640205_at:200:203; Interrogation_Position=625; Antisense; AATCAGGTTGCTGAACCCGTGGTCA
>probe:Drosophila_2:1640205_at:703:599; Interrogation_Position=84; Antisense; TGTCAGTTTGGTGGCAGTGTCATCT

Paste this into a BLAST search page for me
TTGGGACGCTCATCGAAGGTGGATTCTTGTGCCCACTGTGCTTGTGAAAAGGCATAGTGCCCACTGTGTTGGTAACAAATCTTACCTGCCGTCAATGTTGAATGTTGCCGCCGATGTGGAAACGCTGGCCCGACTATGGATCCTATGGATTATGGATCCTATGGCTATCCCGGCGAACTACTACGACTATGGAGCACCCTTGCCCAGACGTCGTTTTGTTAAGCCGCACTACTACCACTGTTTCTGGTGAGTGAGGATTCGCCATCTGTGACTACTGTGACTACCGATGTCGTTCCCGATAATCAGGTTGCTGAACCCGTGGTCATGTCAGTTTGGTGGCAGTGTCATCT

Full Affymetrix probeset data:

Annotations for 1640205_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720