FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640206_at:

>probe:Drosophila_2:1640206_at:621:433; Interrogation_Position=1016; Antisense; GAGTGTGCGTGCTAAAGTGTGCTAA
>probe:Drosophila_2:1640206_at:138:479; Interrogation_Position=1042; Antisense; GTTTAATGTCTAAGTGTGCACGTGA
>probe:Drosophila_2:1640206_at:215:307; Interrogation_Position=1122; Antisense; CCTCTTTTGGCCTTAACTAATGTAT
>probe:Drosophila_2:1640206_at:200:243; Interrogation_Position=1152; Antisense; AATTACCCAGAGATCAGACACGCCC
>probe:Drosophila_2:1640206_at:685:179; Interrogation_Position=1205; Antisense; AAAACTCCTTGGTAGTCCACAGTGT
>probe:Drosophila_2:1640206_at:537:505; Interrogation_Position=1219; Antisense; GTCCACAGTGTGTAAGCTATGATGT
>probe:Drosophila_2:1640206_at:105:635; Interrogation_Position=701; Antisense; TCGCCGGCAGCTGGTGGCATAAGCA
>probe:Drosophila_2:1640206_at:235:521; Interrogation_Position=714; Antisense; GTGGCATAAGCAATCCCGCGATGGA
>probe:Drosophila_2:1640206_at:469:331; Interrogation_Position=815; Antisense; GCGGCGCACTGCTTGAAGCTGAAGC
>probe:Drosophila_2:1640206_at:489:681; Interrogation_Position=883; Antisense; TATGTCGAGCAAGAATCTACGCAGT
>probe:Drosophila_2:1640206_at:373:279; Interrogation_Position=899; Antisense; CTACGCAGTGGCTGCTGACTGGAAT
>probe:Drosophila_2:1640206_at:182:143; Interrogation_Position=916; Antisense; ACTGGAATCGTTGGAGTCGCCGGAA
>probe:Drosophila_2:1640206_at:548:139; Interrogation_Position=959; Antisense; ACGGAAACGCCCATTATTACATGTT
>probe:Drosophila_2:1640206_at:654:699; Interrogation_Position=986; Antisense; TTTTTTCTTGTCTCGCGTGCTTGTG

Paste this into a BLAST search page for me
GAGTGTGCGTGCTAAAGTGTGCTAAGTTTAATGTCTAAGTGTGCACGTGACCTCTTTTGGCCTTAACTAATGTATAATTACCCAGAGATCAGACACGCCCAAAACTCCTTGGTAGTCCACAGTGTGTCCACAGTGTGTAAGCTATGATGTTCGCCGGCAGCTGGTGGCATAAGCAGTGGCATAAGCAATCCCGCGATGGAGCGGCGCACTGCTTGAAGCTGAAGCTATGTCGAGCAAGAATCTACGCAGTCTACGCAGTGGCTGCTGACTGGAATACTGGAATCGTTGGAGTCGCCGGAAACGGAAACGCCCATTATTACATGTTTTTTTTCTTGTCTCGCGTGCTTGTG

Full Affymetrix probeset data:

Annotations for 1640206_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720