FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640207_at:

>probe:Drosophila_2:1640207_at:12:193; Interrogation_Position=1007; Antisense; AACTATACCGTATTCCATTCAGAGA
>probe:Drosophila_2:1640207_at:83:689; Interrogation_Position=540; Antisense; TATTCTGTCCAAGCTGGGTGGCATT
>probe:Drosophila_2:1640207_at:28:519; Interrogation_Position=557; Antisense; GTGGCATTTTTCTGGGAACGCCGTC
>probe:Drosophila_2:1640207_at:124:305; Interrogation_Position=577; Antisense; CCGTCCTTTCTTAGCTGGGTATTAG
>probe:Drosophila_2:1640207_at:188:681; Interrogation_Position=606; Antisense; TATGGAGCTGCTACCTATTACTAAT
>probe:Drosophila_2:1640207_at:501:635; Interrogation_Position=656; Antisense; TCTGTTCCAGTAGCTCCATGTTTAA
>probe:Drosophila_2:1640207_at:688:57; Interrogation_Position=673; Antisense; ATGTTTAACTTTCTGTGCTCTGGTC
>probe:Drosophila_2:1640207_at:77:561; Interrogation_Position=721; Antisense; GGAACACGACACTTGAACCAGACTC
>probe:Drosophila_2:1640207_at:33:203; Interrogation_Position=736; Antisense; AACCAGACTCTGTTGCCGGACGTTT
>probe:Drosophila_2:1640207_at:623:525; Interrogation_Position=779; Antisense; GGGCATCTTCGAGCCAAGTAATCCA
>probe:Drosophila_2:1640207_at:365:627; Interrogation_Position=809; Antisense; TCCAGCTTTACAGGTCAGGCGACTT
>probe:Drosophila_2:1640207_at:349:71; Interrogation_Position=825; Antisense; AGGCGACTTCCGACAGTATGATCAT
>probe:Drosophila_2:1640207_at:150:137; Interrogation_Position=863; Antisense; ACGAAATCATTTACCAGCAGCCAAC
>probe:Drosophila_2:1640207_at:87:443; Interrogation_Position=970; Antisense; GATGTGAAGTATCTGGCCTCACTCC

Paste this into a BLAST search page for me
AACTATACCGTATTCCATTCAGAGATATTCTGTCCAAGCTGGGTGGCATTGTGGCATTTTTCTGGGAACGCCGTCCCGTCCTTTCTTAGCTGGGTATTAGTATGGAGCTGCTACCTATTACTAATTCTGTTCCAGTAGCTCCATGTTTAAATGTTTAACTTTCTGTGCTCTGGTCGGAACACGACACTTGAACCAGACTCAACCAGACTCTGTTGCCGGACGTTTGGGCATCTTCGAGCCAAGTAATCCATCCAGCTTTACAGGTCAGGCGACTTAGGCGACTTCCGACAGTATGATCATACGAAATCATTTACCAGCAGCCAACGATGTGAAGTATCTGGCCTCACTCC

Full Affymetrix probeset data:

Annotations for 1640207_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720