Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640208_s_at:

>probe:Drosophila_2:1640208_s_at:388:705; Interrogation_Position=261; Antisense; TTATCCCAATTGTCAGCCCGCTAAG
>probe:Drosophila_2:1640208_s_at:172:269; Interrogation_Position=277; Antisense; CCCGCTAAGATCATAAAGGCCGTAA
>probe:Drosophila_2:1640208_s_at:594:13; Interrogation_Position=329; Antisense; ATTAGAACCGCAATCAGTCGCACAC
>probe:Drosophila_2:1640208_s_at:170:577; Interrogation_Position=366; Antisense; GGCGCAGATCGTCATAAACCCATTA
>probe:Drosophila_2:1640208_s_at:49:639; Interrogation_Position=421; Antisense; TCGTAATTGTAATCGCAGGCGCCAT
>probe:Drosophila_2:1640208_s_at:702:69; Interrogation_Position=437; Antisense; AGGCGCCATCGCATAAACAGCAAAC
>probe:Drosophila_2:1640208_s_at:387:3; Interrogation_Position=480; Antisense; ATTGGAATTGAACTTCGCGCGCGTT
>probe:Drosophila_2:1640208_s_at:367:323; Interrogation_Position=496; Antisense; GCGCGCGTTTCTTTTTATGATGTTC
>probe:Drosophila_2:1640208_s_at:167:681; Interrogation_Position=511; Antisense; TATGATGTTCGAGTGTCTGGCAGGT
>probe:Drosophila_2:1640208_s_at:273:27; Interrogation_Position=574; Antisense; ATACTACTAATGGATCTGGGCTGAC
>probe:Drosophila_2:1640208_s_at:258:641; Interrogation_Position=588; Antisense; TCTGGGCTGACTGTGCTGCAAATGA
>probe:Drosophila_2:1640208_s_at:212:647; Interrogation_Position=630; Antisense; TCAAGCCAAATCCTACTACCTAAGT
>probe:Drosophila_2:1640208_s_at:587:199; Interrogation_Position=672; Antisense; AACGCATCGTGCACCGAAAACTCGA
>probe:Drosophila_2:1640208_s_at:244:365; Interrogation_Position=695; Antisense; GAATCTGTACAACAACGTTTTCTAG

Paste this into a BLAST search page for me
TTATCCCAATTGTCAGCCCGCTAAGCCCGCTAAGATCATAAAGGCCGTAAATTAGAACCGCAATCAGTCGCACACGGCGCAGATCGTCATAAACCCATTATCGTAATTGTAATCGCAGGCGCCATAGGCGCCATCGCATAAACAGCAAACATTGGAATTGAACTTCGCGCGCGTTGCGCGCGTTTCTTTTTATGATGTTCTATGATGTTCGAGTGTCTGGCAGGTATACTACTAATGGATCTGGGCTGACTCTGGGCTGACTGTGCTGCAAATGATCAAGCCAAATCCTACTACCTAAGTAACGCATCGTGCACCGAAAACTCGAGAATCTGTACAACAACGTTTTCTAG

Full Affymetrix probeset data:

Annotations for 1640208_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime