FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640210_at:

>probe:Drosophila_2:1640210_at:519:663; Interrogation_Position=3489; Antisense; TAAATGCCAAAGCTCTCCATTTCCG
>probe:Drosophila_2:1640210_at:439:617; Interrogation_Position=3528; Antisense; TGCACCATGAGGCACTGCTCCAGAA
>probe:Drosophila_2:1640210_at:189:723; Interrogation_Position=3573; Antisense; TTGCACTCGTGCAGATCCATCAGTT
>probe:Drosophila_2:1640210_at:593:35; Interrogation_Position=3591; Antisense; ATCAGTTGGTTCTCGGCGCGCTCGA
>probe:Drosophila_2:1640210_at:507:635; Interrogation_Position=3612; Antisense; TCGATGGCCGCGTACAGTTTGCACC
>probe:Drosophila_2:1640210_at:444:91; Interrogation_Position=3627; Antisense; AGTTTGCACCTCTCCTCGATGAGTT
>probe:Drosophila_2:1640210_at:211:123; Interrogation_Position=3663; Antisense; AGCGACGTGGTGAAGGCCCAGAACC
>probe:Drosophila_2:1640210_at:400:107; Interrogation_Position=3682; Antisense; AGAACCACTCCAGTTTCTGGTACTC
>probe:Drosophila_2:1640210_at:586:537; Interrogation_Position=3700; Antisense; GGTACTCGCCGCAATGTGGACACAT
>probe:Drosophila_2:1640210_at:408:153; Interrogation_Position=3721; Antisense; ACATGATCAGGTCGGCGCCATTGAA
>probe:Drosophila_2:1640210_at:428:3; Interrogation_Position=3740; Antisense; ATTGAACTCCGGCTGGGTGTACTCC
>probe:Drosophila_2:1640210_at:142:545; Interrogation_Position=3767; Antisense; GGATAGCCACCAACGCAGACTTGGA
>probe:Drosophila_2:1640210_at:522:531; Interrogation_Position=3809; Antisense; GGGTGTGAAGATCTCCATACAGTTT
>probe:Drosophila_2:1640210_at:332:479; Interrogation_Position=3830; Antisense; GTTTGGGTTATCACAACGGTAGCGA

Paste this into a BLAST search page for me
TAAATGCCAAAGCTCTCCATTTCCGTGCACCATGAGGCACTGCTCCAGAATTGCACTCGTGCAGATCCATCAGTTATCAGTTGGTTCTCGGCGCGCTCGATCGATGGCCGCGTACAGTTTGCACCAGTTTGCACCTCTCCTCGATGAGTTAGCGACGTGGTGAAGGCCCAGAACCAGAACCACTCCAGTTTCTGGTACTCGGTACTCGCCGCAATGTGGACACATACATGATCAGGTCGGCGCCATTGAAATTGAACTCCGGCTGGGTGTACTCCGGATAGCCACCAACGCAGACTTGGAGGGTGTGAAGATCTCCATACAGTTTGTTTGGGTTATCACAACGGTAGCGA

Full Affymetrix probeset data:

Annotations for 1640210_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720