FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640211_at:

>probe:Drosophila_2:1640211_at:590:481; Interrogation_Position=1029; Antisense; GTATCAGCGGTGAGCCGATCATCAA
>probe:Drosophila_2:1640211_at:475:373; Interrogation_Position=1060; Antisense; GAAGTGCAACTTCTGGCCGTGAAAA
>probe:Drosophila_2:1640211_at:59:601; Interrogation_Position=1145; Antisense; TGTAACTAGAATTACTCCCCTCACA
>probe:Drosophila_2:1640211_at:199:283; Interrogation_Position=1159; Antisense; CTCCCCTCACAACTAATCATTATAA
>probe:Drosophila_2:1640211_at:660:583; Interrogation_Position=667; Antisense; TGGCTATGTCCTTATGTACTTCAAT
>probe:Drosophila_2:1640211_at:228:697; Interrogation_Position=715; Antisense; TTTAAAGGCGTCCACCAAGCAGCAG
>probe:Drosophila_2:1640211_at:8:461; Interrogation_Position=798; Antisense; GATTTCCCTGCGAGTTCACAATGTA
>probe:Drosophila_2:1640211_at:244:57; Interrogation_Position=818; Antisense; ATGTACTTAAACTACTGCCGCGGCA
>probe:Drosophila_2:1640211_at:42:33; Interrogation_Position=855; Antisense; ATAAGCCCAACTACGACTTCATCTG
>probe:Drosophila_2:1640211_at:712:713; Interrogation_Position=872; Antisense; TTCATCTGCCGCATGTTTCGGATGC
>probe:Drosophila_2:1640211_at:422:639; Interrogation_Position=889; Antisense; TCGGATGCTGCGGAATGGTCTCAAT
>probe:Drosophila_2:1640211_at:452:93; Interrogation_Position=902; Antisense; AATGGTCTCAATCTTCGGCCGGGTC
>probe:Drosophila_2:1640211_at:181:643; Interrogation_Position=930; Antisense; TCTACGACTGGGACATGCTGATGAT
>probe:Drosophila_2:1640211_at:638:231; Interrogation_Position=991; Antisense; AATGCGTGTATTTCCACCTAAACAG

Paste this into a BLAST search page for me
GTATCAGCGGTGAGCCGATCATCAAGAAGTGCAACTTCTGGCCGTGAAAATGTAACTAGAATTACTCCCCTCACACTCCCCTCACAACTAATCATTATAATGGCTATGTCCTTATGTACTTCAATTTTAAAGGCGTCCACCAAGCAGCAGGATTTCCCTGCGAGTTCACAATGTAATGTACTTAAACTACTGCCGCGGCAATAAGCCCAACTACGACTTCATCTGTTCATCTGCCGCATGTTTCGGATGCTCGGATGCTGCGGAATGGTCTCAATAATGGTCTCAATCTTCGGCCGGGTCTCTACGACTGGGACATGCTGATGATAATGCGTGTATTTCCACCTAAACAG

Full Affymetrix probeset data:

Annotations for 1640211_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720