FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640212_at:

>probe:Drosophila_2:1640212_at:673:671; Interrogation_Position=2163; Antisense; TACGACGTCGCAAATGTACCAGCAG
>probe:Drosophila_2:1640212_at:356:111; Interrogation_Position=2204; Antisense; AGCAATTTCTTAACCGTCACAGCAT
>probe:Drosophila_2:1640212_at:239:457; Interrogation_Position=2242; Antisense; GATACGTCCTCAATCGACATCGAAG
>probe:Drosophila_2:1640212_at:511:71; Interrogation_Position=2265; Antisense; AGGAATACCCGATAGCGATTTGCTG
>probe:Drosophila_2:1640212_at:477:293; Interrogation_Position=2280; Antisense; CGATTTGCTGATGTATCCGTATACA
>probe:Drosophila_2:1640212_at:426:713; Interrogation_Position=2376; Antisense; TTCGAAGCCCATTTTAAGACCTCCA
>probe:Drosophila_2:1640212_at:713:211; Interrogation_Position=2391; Antisense; AAGACCTCCAGATGATACTCGTAAG
>probe:Drosophila_2:1640212_at:692:219; Interrogation_Position=2445; Antisense; AAGTGCCTGCATTATATGCCGAACT
>probe:Drosophila_2:1640212_at:604:73; Interrogation_Position=2492; Antisense; AGGAAGCACCTTTCATGGAGCAGAT
>probe:Drosophila_2:1640212_at:28:227; Interrogation_Position=2529; Antisense; AAGGCGTCGGGAACTATTGACATAC
>probe:Drosophila_2:1640212_at:48:161; Interrogation_Position=2581; Antisense; AAATCTTTTAACATCCTGCCCAAGG
>probe:Drosophila_2:1640212_at:6:205; Interrogation_Position=2624; Antisense; AAGCCATCAACATGCATGATCTCAG
>probe:Drosophila_2:1640212_at:234:79; Interrogation_Position=2677; Antisense; AGGATAAATATTTTCGGCACTGCGA
>probe:Drosophila_2:1640212_at:171:431; Interrogation_Position=2700; Antisense; GAGTAGTATGTCTAGTTTCCCTAAG

Paste this into a BLAST search page for me
TACGACGTCGCAAATGTACCAGCAGAGCAATTTCTTAACCGTCACAGCATGATACGTCCTCAATCGACATCGAAGAGGAATACCCGATAGCGATTTGCTGCGATTTGCTGATGTATCCGTATACATTCGAAGCCCATTTTAAGACCTCCAAAGACCTCCAGATGATACTCGTAAGAAGTGCCTGCATTATATGCCGAACTAGGAAGCACCTTTCATGGAGCAGATAAGGCGTCGGGAACTATTGACATACAAATCTTTTAACATCCTGCCCAAGGAAGCCATCAACATGCATGATCTCAGAGGATAAATATTTTCGGCACTGCGAGAGTAGTATGTCTAGTTTCCCTAAG

Full Affymetrix probeset data:

Annotations for 1640212_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720