FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640214_at:

>probe:Drosophila_2:1640214_at:558:135; Interrogation_Position=1267; Antisense; ACGACATCGAGCACACCAAGGAGAA
>probe:Drosophila_2:1640214_at:159:129; Interrogation_Position=1299; Antisense; ACCAGCGATGGCGTTATAGTCCACA
>probe:Drosophila_2:1640214_at:449:679; Interrogation_Position=1315; Antisense; TAGTCCACACTAATCAGGTCAAGGC
>probe:Drosophila_2:1640214_at:402:639; Interrogation_Position=1358; Antisense; TCGTCGTCCTGAACTGGGCTACAAA
>probe:Drosophila_2:1640214_at:92:65; Interrogation_Position=1389; Antisense; ATGGAGCTGAAGAGCCCCGATTCGG
>probe:Drosophila_2:1640214_at:603:463; Interrogation_Position=1407; Antisense; GATTCGGTTCTTTCGCAACGCAATG
>probe:Drosophila_2:1640214_at:465:583; Interrogation_Position=1430; Antisense; TGGCTTCAGGCCCTCATACTAAATG
>probe:Drosophila_2:1640214_at:576:239; Interrogation_Position=1468; Antisense; AATCACGCTAGGCTTATTTTCATGG
>probe:Drosophila_2:1640214_at:112:61; Interrogation_Position=1508; Antisense; AGGCTTTTGTGTAGTCGACGGTTAG
>probe:Drosophila_2:1640214_at:369:97; Interrogation_Position=1555; Antisense; AGATCACCTGTGAAGTGCCTCTGTA
>probe:Drosophila_2:1640214_at:602:285; Interrogation_Position=1575; Antisense; CTGTAGTTTGGCTAGCTTTTGCTAA
>probe:Drosophila_2:1640214_at:219:701; Interrogation_Position=1626; Antisense; TTTTAAGCCTGTTATCCATGTGGAT
>probe:Drosophila_2:1640214_at:557:509; Interrogation_Position=1693; Antisense; GTGCAAAGTTCTTGCCTACGGAGAT
>probe:Drosophila_2:1640214_at:683:215; Interrogation_Position=1742; Antisense; AAGTATTACCGAGCTCTCTCTATAA

Paste this into a BLAST search page for me
ACGACATCGAGCACACCAAGGAGAAACCAGCGATGGCGTTATAGTCCACATAGTCCACACTAATCAGGTCAAGGCTCGTCGTCCTGAACTGGGCTACAAAATGGAGCTGAAGAGCCCCGATTCGGGATTCGGTTCTTTCGCAACGCAATGTGGCTTCAGGCCCTCATACTAAATGAATCACGCTAGGCTTATTTTCATGGAGGCTTTTGTGTAGTCGACGGTTAGAGATCACCTGTGAAGTGCCTCTGTACTGTAGTTTGGCTAGCTTTTGCTAATTTTAAGCCTGTTATCCATGTGGATGTGCAAAGTTCTTGCCTACGGAGATAAGTATTACCGAGCTCTCTCTATAA

Full Affymetrix probeset data:

Annotations for 1640214_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720