FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640215_at:

>probe:Drosophila_2:1640215_at:12:147; Interrogation_Position=353; Antisense; CACGCCTAGGACTCATTTCAAATCT
>probe:Drosophila_2:1640215_at:727:405; Interrogation_Position=380; Antisense; GACTGGGTCAGAAGTTTCCTGGCCT
>probe:Drosophila_2:1640215_at:50:635; Interrogation_Position=412; Antisense; TCGCCCGTTGGCCAGTTGTGTGTAA
>probe:Drosophila_2:1640215_at:721:93; Interrogation_Position=425; Antisense; AGTTGTGTGTAAGTCCGCTGGATCG
>probe:Drosophila_2:1640215_at:479:587; Interrogation_Position=443; Antisense; TGGATCGCGATGTGGTGGCCTCTTC
>probe:Drosophila_2:1640215_at:295:513; Interrogation_Position=478; Antisense; GTGATCGACTGCTCGTGGGCCAAGC
>probe:Drosophila_2:1640215_at:321:669; Interrogation_Position=583; Antisense; TACGGAAAGCCCTGCAAGCTCAGCT
>probe:Drosophila_2:1640215_at:518:205; Interrogation_Position=598; Antisense; AAGCTCAGCTGCGTGGAGGCCATAG
>probe:Drosophila_2:1640215_at:75:27; Interrogation_Position=619; Antisense; ATAGCCGCCACTCTATACATCTGTG
>probe:Drosophila_2:1640215_at:581:213; Interrogation_Position=653; Antisense; AAGAGGCTCGCTGGTTTCTGGGCAA
>probe:Drosophila_2:1640215_at:598:531; Interrogation_Position=687; Antisense; GGGTCATGCCTTTCTGGAGCTAAAC
>probe:Drosophila_2:1640215_at:251:177; Interrogation_Position=708; Antisense; AAACGACAAGCTTCTCAATGCCTAT
>probe:Drosophila_2:1640215_at:3:31; Interrogation_Position=806; Antisense; ATAAGCCTAGGGATCTTCGCGACTT
>probe:Drosophila_2:1640215_at:559:149; Interrogation_Position=827; Antisense; ACTTCTATCCCACCAGCAGTAGTAG

Paste this into a BLAST search page for me
CACGCCTAGGACTCATTTCAAATCTGACTGGGTCAGAAGTTTCCTGGCCTTCGCCCGTTGGCCAGTTGTGTGTAAAGTTGTGTGTAAGTCCGCTGGATCGTGGATCGCGATGTGGTGGCCTCTTCGTGATCGACTGCTCGTGGGCCAAGCTACGGAAAGCCCTGCAAGCTCAGCTAAGCTCAGCTGCGTGGAGGCCATAGATAGCCGCCACTCTATACATCTGTGAAGAGGCTCGCTGGTTTCTGGGCAAGGGTCATGCCTTTCTGGAGCTAAACAAACGACAAGCTTCTCAATGCCTATATAAGCCTAGGGATCTTCGCGACTTACTTCTATCCCACCAGCAGTAGTAG

Full Affymetrix probeset data:

Annotations for 1640215_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720