Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640216_at:

>probe:Drosophila_2:1640216_at:180:319; Interrogation_Position=1032; Antisense; GCCCTCATGGGACCCTGGTTAATGA
>probe:Drosophila_2:1640216_at:517:377; Interrogation_Position=1057; Antisense; GAAGCTTTAACAGACGTCTCATGAT
>probe:Drosophila_2:1640216_at:190:619; Interrogation_Position=1098; Antisense; TGCTCTGCAATCTTTTTGGTCCTAC
>probe:Drosophila_2:1640216_at:603:277; Interrogation_Position=1119; Antisense; CTACTTGTCGTTGGCCTGGAACTAA
>probe:Drosophila_2:1640216_at:13:153; Interrogation_Position=1154; Antisense; ACATGAGTTCTCATTCACCTGCATC
>probe:Drosophila_2:1640216_at:130:503; Interrogation_Position=1187; Antisense; GTCGCTGTACATCATCACATTCAAC
>probe:Drosophila_2:1640216_at:556:457; Interrogation_Position=1250; Antisense; GATATTTGAGACAGCTTCGCGTCCT
>probe:Drosophila_2:1640216_at:234:641; Interrogation_Position=1275; Antisense; TCGGCAATGGCCCTAGGAAGCTTTT
>probe:Drosophila_2:1640216_at:305:195; Interrogation_Position=1302; Antisense; AACTGGCTGGCTAACTTCGTGCTAA
>probe:Drosophila_2:1640216_at:384:713; Interrogation_Position=1317; Antisense; TTCGTGCTAAACATGATCTTCCCCA
>probe:Drosophila_2:1640216_at:349:325; Interrogation_Position=1353; Antisense; GCGACTGGACCATTTGTGTTCCTAT
>probe:Drosophila_2:1640216_at:65:625; Interrogation_Position=1394; Antisense; TGCCTACGGGTTCCTGTTAACCTAT
>probe:Drosophila_2:1640216_at:154:475; Interrogation_Position=1409; Antisense; GTTAACCTATCGATATCTTCCAGAG
>probe:Drosophila_2:1640216_at:268:407; Interrogation_Position=1535; Antisense; GACTGGTGATTATTTGCCCATGCTT

Paste this into a BLAST search page for me
GCCCTCATGGGACCCTGGTTAATGAGAAGCTTTAACAGACGTCTCATGATTGCTCTGCAATCTTTTTGGTCCTACCTACTTGTCGTTGGCCTGGAACTAAACATGAGTTCTCATTCACCTGCATCGTCGCTGTACATCATCACATTCAACGATATTTGAGACAGCTTCGCGTCCTTCGGCAATGGCCCTAGGAAGCTTTTAACTGGCTGGCTAACTTCGTGCTAATTCGTGCTAAACATGATCTTCCCCAGCGACTGGACCATTTGTGTTCCTATTGCCTACGGGTTCCTGTTAACCTATGTTAACCTATCGATATCTTCCAGAGGACTGGTGATTATTTGCCCATGCTT

Full Affymetrix probeset data:

Annotations for 1640216_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime