FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640217_at:

>probe:Drosophila_2:1640217_at:85:629; Interrogation_Position=124; Antisense; TCCAATTCTGGACCCCATGGCGGAC
>probe:Drosophila_2:1640217_at:371:383; Interrogation_Position=13; Antisense; GAACTCCTCGGCTTGATCATGTACC
>probe:Drosophila_2:1640217_at:697:213; Interrogation_Position=167; Antisense; AAGAGTCCACCGACAATATAGTCAT
>probe:Drosophila_2:1640217_at:103:173; Interrogation_Position=202; Antisense; AACAGCGGCAAGTGGCGTTACTAAA
>probe:Drosophila_2:1640217_at:584:567; Interrogation_Position=238; Antisense; GGCAGAGGCGTGACCACAACCAAGT
>probe:Drosophila_2:1640217_at:610:693; Interrogation_Position=307; Antisense; TTTGCTTCGCAATTGATTTTCGTCG
>probe:Drosophila_2:1640217_at:18:61; Interrogation_Position=31; Antisense; ATGTACCTACGTCAACAACTCTGGG
>probe:Drosophila_2:1640217_at:367:385; Interrogation_Position=331; Antisense; GAACAGTACTCGATTTGTATGCTAA
>probe:Drosophila_2:1640217_at:571:29; Interrogation_Position=355; Antisense; ATACTTCATTCATGGTCACACTCAC
>probe:Drosophila_2:1640217_at:295:249; Interrogation_Position=397; Antisense; AATTGTGCACCTTTTTATCTATGAC
>probe:Drosophila_2:1640217_at:133:31; Interrogation_Position=430; Antisense; ATAACCCTTTACTATACTGTATGTA
>probe:Drosophila_2:1640217_at:652:185; Interrogation_Position=44; Antisense; AACAACTCTGGGTTCTCTTGCTCTG
>probe:Drosophila_2:1640217_at:696:715; Interrogation_Position=76; Antisense; TTCGTCGTTCTCAGCGTGCATGGCA
>probe:Drosophila_2:1640217_at:590:121; Interrogation_Position=88; Antisense; AGCGTGCATGGCATGCCGTGGAAAT

Paste this into a BLAST search page for me
TCCAATTCTGGACCCCATGGCGGACGAACTCCTCGGCTTGATCATGTACCAAGAGTCCACCGACAATATAGTCATAACAGCGGCAAGTGGCGTTACTAAAGGCAGAGGCGTGACCACAACCAAGTTTTGCTTCGCAATTGATTTTCGTCGATGTACCTACGTCAACAACTCTGGGGAACAGTACTCGATTTGTATGCTAAATACTTCATTCATGGTCACACTCACAATTGTGCACCTTTTTATCTATGACATAACCCTTTACTATACTGTATGTAAACAACTCTGGGTTCTCTTGCTCTGTTCGTCGTTCTCAGCGTGCATGGCAAGCGTGCATGGCATGCCGTGGAAAT

Full Affymetrix probeset data:

Annotations for 1640217_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720