FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640218_at:

>probe:Drosophila_2:1640218_at:360:599; Interrogation_Position=334; Antisense; TGTCAGAAACTGATGCCTCCACGAT
>probe:Drosophila_2:1640218_at:432:701; Interrogation_Position=389; Antisense; TTTTGAAGCGAGACCACCACTGCAT
>probe:Drosophila_2:1640218_at:704:33; Interrogation_Position=443; Antisense; ATCACCGATATTTCTTCTGGCTTAC
>probe:Drosophila_2:1640218_at:536:641; Interrogation_Position=458; Antisense; TCTGGCTTACATTCTATTTGGCATT
>probe:Drosophila_2:1640218_at:335:269; Interrogation_Position=492; Antisense; CATGAGCATGGCAACCCTATTTGTT
>probe:Drosophila_2:1640218_at:161:223; Interrogation_Position=525; Antisense; AAGGAGCTTTTATCTTTTGCACAGA
>probe:Drosophila_2:1640218_at:621:637; Interrogation_Position=594; Antisense; TCGGTACGTGTGCTTGATTCTCAAT
>probe:Drosophila_2:1640218_at:281:463; Interrogation_Position=609; Antisense; GATTCTCAATATATTTGCCCTCGGA
>probe:Drosophila_2:1640218_at:71:149; Interrogation_Position=689; Antisense; ACTATCAAATTTCCAGTCGCCATCA
>probe:Drosophila_2:1640218_at:195:635; Interrogation_Position=705; Antisense; TCGCCATCACGATTTGGGTTTCCGA
>probe:Drosophila_2:1640218_at:120:541; Interrogation_Position=721; Antisense; GGTTTCCGAAATAACTGCCAGCTTA
>probe:Drosophila_2:1640218_at:509:537; Interrogation_Position=751; Antisense; GGTCAGCGAGGACTCTGGACTTTTA
>probe:Drosophila_2:1640218_at:396:149; Interrogation_Position=769; Antisense; ACTTTTATATCTCCCTCGCTGAGAA
>probe:Drosophila_2:1640218_at:205:423; Interrogation_Position=789; Antisense; GAGAAGTCCTTTGCCGCATGATGGA

Paste this into a BLAST search page for me
TGTCAGAAACTGATGCCTCCACGATTTTTGAAGCGAGACCACCACTGCATATCACCGATATTTCTTCTGGCTTACTCTGGCTTACATTCTATTTGGCATTCATGAGCATGGCAACCCTATTTGTTAAGGAGCTTTTATCTTTTGCACAGATCGGTACGTGTGCTTGATTCTCAATGATTCTCAATATATTTGCCCTCGGAACTATCAAATTTCCAGTCGCCATCATCGCCATCACGATTTGGGTTTCCGAGGTTTCCGAAATAACTGCCAGCTTAGGTCAGCGAGGACTCTGGACTTTTAACTTTTATATCTCCCTCGCTGAGAAGAGAAGTCCTTTGCCGCATGATGGA

Full Affymetrix probeset data:

Annotations for 1640218_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720