FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640221_at:

>probe:Drosophila_2:1640221_at:178:87; Interrogation_Position=1106; Antisense; AGTACGCCGCGACATTTCGAACTGG
>probe:Drosophila_2:1640221_at:386:285; Interrogation_Position=1127; Antisense; CTGGTCCTGCGACTCGAGAGGAACA
>probe:Drosophila_2:1640221_at:600:221; Interrogation_Position=1154; Antisense; AAGGTCAAGACCTATCCCGTGCAGT
>probe:Drosophila_2:1640221_at:268:99; Interrogation_Position=1191; Antisense; AGATGTACCGCCTGAAGGGAGCCAA
>probe:Drosophila_2:1640221_at:688:389; Interrogation_Position=1216; Antisense; GAAACAGTTCACCAGCCTGAAAGCG
>probe:Drosophila_2:1640221_at:355:511; Interrogation_Position=1259; Antisense; GTGATGGCCGAACAACTGCCATTGG
>probe:Drosophila_2:1640221_at:73:145; Interrogation_Position=1273; Antisense; ACTGCCATTGGTATTGGATATGCCC
>probe:Drosophila_2:1640221_at:361:417; Interrogation_Position=1301; Antisense; GAGCGTCATGTGGTGAAGCCCTCAT
>probe:Drosophila_2:1640221_at:5:205; Interrogation_Position=1316; Antisense; AAGCCCTCATCAGTGCGCTATGCAG
>probe:Drosophila_2:1640221_at:12:55; Interrogation_Position=1335; Antisense; ATGCAGATGACTTCGAGCCGCTGGA
>probe:Drosophila_2:1640221_at:534:587; Interrogation_Position=1356; Antisense; TGGAGTCCCTGCAGCTACTCGGCAT
>probe:Drosophila_2:1640221_at:56:669; Interrogation_Position=1371; Antisense; TACTCGGCATCCTGAGGAGTCTGCA
>probe:Drosophila_2:1640221_at:540:573; Interrogation_Position=1552; Antisense; GGCTGAGCAACCCTCGAATTTAGTT
>probe:Drosophila_2:1640221_at:304:15; Interrogation_Position=1599; Antisense; ATTTTGTATCCGACATAGGGCTAAG

Paste this into a BLAST search page for me
AGTACGCCGCGACATTTCGAACTGGCTGGTCCTGCGACTCGAGAGGAACAAAGGTCAAGACCTATCCCGTGCAGTAGATGTACCGCCTGAAGGGAGCCAAGAAACAGTTCACCAGCCTGAAAGCGGTGATGGCCGAACAACTGCCATTGGACTGCCATTGGTATTGGATATGCCCGAGCGTCATGTGGTGAAGCCCTCATAAGCCCTCATCAGTGCGCTATGCAGATGCAGATGACTTCGAGCCGCTGGATGGAGTCCCTGCAGCTACTCGGCATTACTCGGCATCCTGAGGAGTCTGCAGGCTGAGCAACCCTCGAATTTAGTTATTTTGTATCCGACATAGGGCTAAG

Full Affymetrix probeset data:

Annotations for 1640221_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720