FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640226_at:

>probe:Drosophila_2:1640226_at:681:541; Interrogation_Position=102; Antisense; GGTTGCCACCTATGCGGCACCAGCT
>probe:Drosophila_2:1640226_at:387:211; Interrogation_Position=142; Antisense; AAGACCGTCGCCCAACCGGTGCTGG
>probe:Drosophila_2:1640226_at:421:509; Interrogation_Position=220; Antisense; GTGCAGGACGCCATCTCGGGCGACT
>probe:Drosophila_2:1640226_at:414:271; Interrogation_Position=231; Antisense; CATCTCGGGCGACTCCAAGAGCCAG
>probe:Drosophila_2:1640226_at:59:719; Interrogation_Position=306; Antisense; TTCCGATGGCTTCAAGCGCACGGTG
>probe:Drosophila_2:1640226_at:549:651; Interrogation_Position=317; Antisense; TCAAGCGCACGGTGCAGTACACTGC
>probe:Drosophila_2:1640226_at:69:91; Interrogation_Position=332; Antisense; AGTACACTGCCGATCCAATCAATGG
>probe:Drosophila_2:1640226_at:63:145; Interrogation_Position=337; Antisense; ACTGCCGATCCAATCAATGGATTCA
>probe:Drosophila_2:1640226_at:509:227; Interrogation_Position=352; Antisense; AATGGATTCAATGCCGTGGTCAATC
>probe:Drosophila_2:1640226_at:332:711; Interrogation_Position=358; Antisense; TTCAATGCCGTGGTCAATCGCGAAC
>probe:Drosophila_2:1640226_at:162:591; Interrogation_Position=368; Antisense; TGGTCAATCGCGAACCGCTGGTGAA
>probe:Drosophila_2:1640226_at:83:41; Interrogation_Position=374; Antisense; ATCGCGAACCGCTGGTGAAGACCGT
>probe:Drosophila_2:1640226_at:475:201; Interrogation_Position=380; Antisense; AACCGCTGGTGAAGACCGTGGTCAA
>probe:Drosophila_2:1640226_at:459:265; Interrogation_Position=82; Antisense; CAGTTGTACCATGCTGCTCCGGTTG

Paste this into a BLAST search page for me
GGTTGCCACCTATGCGGCACCAGCTAAGACCGTCGCCCAACCGGTGCTGGGTGCAGGACGCCATCTCGGGCGACTCATCTCGGGCGACTCCAAGAGCCAGTTCCGATGGCTTCAAGCGCACGGTGTCAAGCGCACGGTGCAGTACACTGCAGTACACTGCCGATCCAATCAATGGACTGCCGATCCAATCAATGGATTCAAATGGATTCAATGCCGTGGTCAATCTTCAATGCCGTGGTCAATCGCGAACTGGTCAATCGCGAACCGCTGGTGAAATCGCGAACCGCTGGTGAAGACCGTAACCGCTGGTGAAGACCGTGGTCAACAGTTGTACCATGCTGCTCCGGTTG

Full Affymetrix probeset data:

Annotations for 1640226_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720