Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640227_at:

>probe:Drosophila_2:1640227_at:67:123; Interrogation_Position=1752; Antisense; AGCGAGAACGCCAACTTCACCAAGT
>probe:Drosophila_2:1640227_at:478:251; Interrogation_Position=1772; Antisense; CAAGTCCGTGGTGGATCTGCGTCGT
>probe:Drosophila_2:1640227_at:287:467; Interrogation_Position=1809; Antisense; GTTGGCTCCAAGAAGGTGCCCATGC
>probe:Drosophila_2:1640227_at:524:387; Interrogation_Position=1845; Antisense; GACAAGGAGTCCTCTGCGGTGGTCA
>probe:Drosophila_2:1640227_at:37:377; Interrogation_Position=1871; Antisense; GAAGACTGGTCAGCCTCTGAAGCGG
>probe:Drosophila_2:1640227_at:221:323; Interrogation_Position=1904; Antisense; GCGCGACACACTGGGCATCAAGAAC
>probe:Drosophila_2:1640227_at:107:357; Interrogation_Position=1949; Antisense; GCAAATTATGGCCAAGCGGGATATT
>probe:Drosophila_2:1640227_at:561:545; Interrogation_Position=2012; Antisense; GGATCGCTTCATCGGCACCAAGATG
>probe:Drosophila_2:1640227_at:97:97; Interrogation_Position=2032; Antisense; AGATGCCGAAGCATTTGTTCTCCGG
>probe:Drosophila_2:1640227_at:382:687; Interrogation_Position=2045; Antisense; TTTGTTCTCCGGCAAGCGTGGAAAT
>probe:Drosophila_2:1640227_at:684:407; Interrogation_Position=2075; Antisense; GACGGATCGCCGTTAAGCGCCGCAG
>probe:Drosophila_2:1640227_at:243:347; Interrogation_Position=2096; Antisense; GCAGCCTTGGCTGGTTAAGTGATTC
>probe:Drosophila_2:1640227_at:707:299; Interrogation_Position=2134; Antisense; CGCCTGCTCCTCTGTATAAACTAAG
>probe:Drosophila_2:1640227_at:333:279; Interrogation_Position=2154; Antisense; CTAAGCGTCTATCTTTATCCCTGAA

Paste this into a BLAST search page for me
AGCGAGAACGCCAACTTCACCAAGTCAAGTCCGTGGTGGATCTGCGTCGTGTTGGCTCCAAGAAGGTGCCCATGCGACAAGGAGTCCTCTGCGGTGGTCAGAAGACTGGTCAGCCTCTGAAGCGGGCGCGACACACTGGGCATCAAGAACGCAAATTATGGCCAAGCGGGATATTGGATCGCTTCATCGGCACCAAGATGAGATGCCGAAGCATTTGTTCTCCGGTTTGTTCTCCGGCAAGCGTGGAAATGACGGATCGCCGTTAAGCGCCGCAGGCAGCCTTGGCTGGTTAAGTGATTCCGCCTGCTCCTCTGTATAAACTAAGCTAAGCGTCTATCTTTATCCCTGAA

Full Affymetrix probeset data:

Annotations for 1640227_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime