Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640228_at:

>probe:Drosophila_2:1640228_at:351:445; Interrogation_Position=1437; Antisense; GATCGAAAGTATTTTTACGGCCCAG
>probe:Drosophila_2:1640228_at:650:137; Interrogation_Position=1453; Antisense; ACGGCCCAGTGGATAGGTTGTTTAT
>probe:Drosophila_2:1640228_at:519:393; Interrogation_Position=1575; Antisense; GAAATCCCTAATCTATACCTACATA
>probe:Drosophila_2:1640228_at:185:477; Interrogation_Position=1601; Antisense; GTTTAAACGTAAATCGCCAGACTCG
>probe:Drosophila_2:1640228_at:653:311; Interrogation_Position=1616; Antisense; GCCAGACTCGTTTCGATTGGTTTGC
>probe:Drosophila_2:1640228_at:719:537; Interrogation_Position=1634; Antisense; GGTTTGCAGTTTGTCCACGGTTAAG
>probe:Drosophila_2:1640228_at:506:225; Interrogation_Position=1656; Antisense; AAGGACGTGGTTTCAGTTCAGTTGT
>probe:Drosophila_2:1640228_at:468:473; Interrogation_Position=1671; Antisense; GTTCAGTTGTTTGCCAACCAGTTGT
>probe:Drosophila_2:1640228_at:332:203; Interrogation_Position=1686; Antisense; AACCAGTTGTATTACCACATCAGCA
>probe:Drosophila_2:1640228_at:533:263; Interrogation_Position=1706; Antisense; CAGCAATCTGTGCAGGACCGAAGAT
>probe:Drosophila_2:1640228_at:480:151; Interrogation_Position=1756; Antisense; ACATATTTATCTATCGACTCGCGCG
>probe:Drosophila_2:1640228_at:187:515; Interrogation_Position=1780; Antisense; GTGTCAGTTGCCAGGGTCCAATTCT
>probe:Drosophila_2:1640228_at:620:505; Interrogation_Position=1795; Antisense; GTCCAATTCTGGGTCGCTAATCTTT
>probe:Drosophila_2:1640228_at:144:559; Interrogation_Position=1841; Antisense; GGACACGCAAAACGAACTGCCACAA

Paste this into a BLAST search page for me
GATCGAAAGTATTTTTACGGCCCAGACGGCCCAGTGGATAGGTTGTTTATGAAATCCCTAATCTATACCTACATAGTTTAAACGTAAATCGCCAGACTCGGCCAGACTCGTTTCGATTGGTTTGCGGTTTGCAGTTTGTCCACGGTTAAGAAGGACGTGGTTTCAGTTCAGTTGTGTTCAGTTGTTTGCCAACCAGTTGTAACCAGTTGTATTACCACATCAGCACAGCAATCTGTGCAGGACCGAAGATACATATTTATCTATCGACTCGCGCGGTGTCAGTTGCCAGGGTCCAATTCTGTCCAATTCTGGGTCGCTAATCTTTGGACACGCAAAACGAACTGCCACAA

Full Affymetrix probeset data:

Annotations for 1640228_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime