Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640229_at:

>probe:Drosophila_2:1640229_at:220:139; Interrogation_Position=2495; Antisense; ACGTTCGACACGTACTTGAAATGCA
>probe:Drosophila_2:1640229_at:355:605; Interrogation_Position=2600; Antisense; TGATATCAAAATTAGCCTCTGCATG
>probe:Drosophila_2:1640229_at:482:675; Interrogation_Position=2634; Antisense; TAGCTAACAAACGACGGCTGCTTTG
>probe:Drosophila_2:1640229_at:587:341; Interrogation_Position=2653; Antisense; GCTTTGGCCAACGTAACACCAGTGA
>probe:Drosophila_2:1640229_at:215:129; Interrogation_Position=2670; Antisense; ACCAGTGACAATTCAGTTAGTTCTA
>probe:Drosophila_2:1640229_at:484:473; Interrogation_Position=2713; Antisense; GTTAAGTTACTACAATCCAACCATG
>probe:Drosophila_2:1640229_at:278:665; Interrogation_Position=2723; Antisense; TACAATCCAACCATGTTCATCCTCA
>probe:Drosophila_2:1640229_at:712:257; Interrogation_Position=2757; Antisense; CACACACTCTACAGCGCAAACGTTG
>probe:Drosophila_2:1640229_at:590:119; Interrogation_Position=2797; Antisense; GAGTGGACTTAGTGCTTAAATTTCC
>probe:Drosophila_2:1640229_at:513:405; Interrogation_Position=2829; Antisense; GACGGAATAGTACCACTACCACACT
>probe:Drosophila_2:1640229_at:44:483; Interrogation_Position=2838; Antisense; GTACCACTACCACACTCGTGGAATA
>probe:Drosophila_2:1640229_at:334:337; Interrogation_Position=2958; Antisense; GCTTACGAAACAAACGCTTATCTGA
>probe:Drosophila_2:1640229_at:583:341; Interrogation_Position=2973; Antisense; GCTTATCTGAAAAAGGCAGTCGTCT
>probe:Drosophila_2:1640229_at:380:355; Interrogation_Position=3021; Antisense; GCACACTTTTAAACACCATTCCTTA

Paste this into a BLAST search page for me
ACGTTCGACACGTACTTGAAATGCATGATATCAAAATTAGCCTCTGCATGTAGCTAACAAACGACGGCTGCTTTGGCTTTGGCCAACGTAACACCAGTGAACCAGTGACAATTCAGTTAGTTCTAGTTAAGTTACTACAATCCAACCATGTACAATCCAACCATGTTCATCCTCACACACACTCTACAGCGCAAACGTTGGAGTGGACTTAGTGCTTAAATTTCCGACGGAATAGTACCACTACCACACTGTACCACTACCACACTCGTGGAATAGCTTACGAAACAAACGCTTATCTGAGCTTATCTGAAAAAGGCAGTCGTCTGCACACTTTTAAACACCATTCCTTA

Full Affymetrix probeset data:

Annotations for 1640229_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime