FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640230_at:

>probe:Drosophila_2:1640230_at:112:467; Interrogation_Position=110; Antisense; GTTGGATATCTGACAAATACACCCC
>probe:Drosophila_2:1640230_at:228:159; Interrogation_Position=122; Antisense; ACAAATACACCCCATACAGTCGCAT
>probe:Drosophila_2:1640230_at:703:63; Interrogation_Position=13; Antisense; ATGTGGCCAATTGTTATGGCTCTAA
>probe:Drosophila_2:1640230_at:171:667; Interrogation_Position=136; Antisense; TACAGTCGCATCCATACAAGAGTTG
>probe:Drosophila_2:1640230_at:141:101; Interrogation_Position=154; Antisense; AGAGTTGCGCGCTAAACGGTTGACA
>probe:Drosophila_2:1640230_at:179:391; Interrogation_Position=182; Antisense; GAAAGTTTGAATACAGATGCCGCTA
>probe:Drosophila_2:1640230_at:417:265; Interrogation_Position=195; Antisense; CAGATGCCGCTAATGTGGAAAAATT
>probe:Drosophila_2:1640230_at:89:245; Interrogation_Position=216; Antisense; AATTACGACTGAGTAGTCCCGTACT
>probe:Drosophila_2:1640230_at:93:429; Interrogation_Position=226; Antisense; GAGTAGTCCCGTACTGGAACGCAAC
>probe:Drosophila_2:1640230_at:114:703; Interrogation_Position=26; Antisense; TTATGGCTCTAATTAGGCGTAACGC
>probe:Drosophila_2:1640230_at:675:69; Interrogation_Position=40; Antisense; AGGCGTAACGCCGTTTACATCACGT
>probe:Drosophila_2:1640230_at:139:699; Interrogation_Position=53; Antisense; TTTACATCACGTTGCCCATAGCCGG
>probe:Drosophila_2:1640230_at:340:307; Interrogation_Position=68; Antisense; CCATAGCCGGCGTTGTGGGTTTTAT
>probe:Drosophila_2:1640230_at:247:327; Interrogation_Position=77; Antisense; GCGTTGTGGGTTTTATTGGCTATAA

Paste this into a BLAST search page for me
GTTGGATATCTGACAAATACACCCCACAAATACACCCCATACAGTCGCATATGTGGCCAATTGTTATGGCTCTAATACAGTCGCATCCATACAAGAGTTGAGAGTTGCGCGCTAAACGGTTGACAGAAAGTTTGAATACAGATGCCGCTACAGATGCCGCTAATGTGGAAAAATTAATTACGACTGAGTAGTCCCGTACTGAGTAGTCCCGTACTGGAACGCAACTTATGGCTCTAATTAGGCGTAACGCAGGCGTAACGCCGTTTACATCACGTTTTACATCACGTTGCCCATAGCCGGCCATAGCCGGCGTTGTGGGTTTTATGCGTTGTGGGTTTTATTGGCTATAA

Full Affymetrix probeset data:

Annotations for 1640230_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720