FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640233_at:

>probe:Drosophila_2:1640233_at:491:77; Interrogation_Position=1639; Antisense; AAATCTGCGCGTCAAAAATTTGCCA
>probe:Drosophila_2:1640233_at:131:695; Interrogation_Position=1657; Antisense; TTTGCCAATGGGAGCACATATTATA
>probe:Drosophila_2:1640233_at:531:271; Interrogation_Position=1684; Antisense; CATCTATTTGTATTTGCCTTGGAGA
>probe:Drosophila_2:1640233_at:211:483; Interrogation_Position=1693; Antisense; GTATTTGCCTTGGAGACACCATCAA
>probe:Drosophila_2:1640233_at:379:399; Interrogation_Position=1707; Antisense; GACACCATCAAATTGCATGACTTGT
>probe:Drosophila_2:1640233_at:596:657; Interrogation_Position=1738; Antisense; TTAAAGCCACGGAGGATCGAAGATC
>probe:Drosophila_2:1640233_at:103:637; Interrogation_Position=1754; Antisense; TCGAAGATCCAAGGGCTTGCTGCAT
>probe:Drosophila_2:1640233_at:303:571; Interrogation_Position=1767; Antisense; GGCTTGCTGCATTCGTTTATATAAC
>probe:Drosophila_2:1640233_at:224:277; Interrogation_Position=1791; Antisense; CTATCAATCTAAGTGTACGTTTAAA
>probe:Drosophila_2:1640233_at:166:175; Interrogation_Position=1820; Antisense; AAACCACATTGGATGGTCCACCCGA
>probe:Drosophila_2:1640233_at:201:3; Interrogation_Position=1827; Antisense; ATTGGATGGTCCACCCGATGTCATT
>probe:Drosophila_2:1640233_at:27:133; Interrogation_Position=1839; Antisense; ACCCGATGTCATTCCCAAATGTTTC
>probe:Drosophila_2:1640233_at:612:9; Interrogation_Position=1849; Antisense; ATTCCCAAATGTTTCTAATACTTAG
>probe:Drosophila_2:1640233_at:12:13; Interrogation_Position=1881; Antisense; ATTAGAAAATCATGCATTGCGGTTA

Paste this into a BLAST search page for me
AAATCTGCGCGTCAAAAATTTGCCATTTGCCAATGGGAGCACATATTATACATCTATTTGTATTTGCCTTGGAGAGTATTTGCCTTGGAGACACCATCAAGACACCATCAAATTGCATGACTTGTTTAAAGCCACGGAGGATCGAAGATCTCGAAGATCCAAGGGCTTGCTGCATGGCTTGCTGCATTCGTTTATATAACCTATCAATCTAAGTGTACGTTTAAAAAACCACATTGGATGGTCCACCCGAATTGGATGGTCCACCCGATGTCATTACCCGATGTCATTCCCAAATGTTTCATTCCCAAATGTTTCTAATACTTAGATTAGAAAATCATGCATTGCGGTTA

Full Affymetrix probeset data:

Annotations for 1640233_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720