FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640235_at:

>probe:Drosophila_2:1640235_at:695:71; Interrogation_Position=3430; Antisense; AGGAATCATCCTTGCTTTATCCCCT
>probe:Drosophila_2:1640235_at:11:705; Interrogation_Position=3446; Antisense; TTATCCCCTGCTTATTGCTAATTAG
>probe:Drosophila_2:1640235_at:144:705; Interrogation_Position=3467; Antisense; TTAGTTTTCACAATGATCTCGGTAA
>probe:Drosophila_2:1640235_at:3:607; Interrogation_Position=3480; Antisense; TGATCTCGGTAAAGTTTTGTGGCCT
>probe:Drosophila_2:1640235_at:240:91; Interrogation_Position=3492; Antisense; AGTTTTGTGGCCTTGCGCCCAAAAG
>probe:Drosophila_2:1640235_at:158:723; Interrogation_Position=3504; Antisense; TTGCGCCCAAAAGTCGTACAGATTT
>probe:Drosophila_2:1640235_at:138:499; Interrogation_Position=3516; Antisense; GTCGTACAGATTTTTGGTTTGCCAT
>probe:Drosophila_2:1640235_at:246:591; Interrogation_Position=3530; Antisense; TGGTTTGCCATAAATACTCGAACAA
>probe:Drosophila_2:1640235_at:678:409; Interrogation_Position=3621; Antisense; GACCCAATGCTACTTAATCCGTTTT
>probe:Drosophila_2:1640235_at:521:211; Interrogation_Position=3654; Antisense; AAGTATCTTTACTCGACCTTGTATA
>probe:Drosophila_2:1640235_at:540:413; Interrogation_Position=3668; Antisense; GACCTTGTATATAGCGCAGTTCGAA
>probe:Drosophila_2:1640235_at:11:367; Interrogation_Position=3690; Antisense; GAATCACAGAATCAAATGCCATTTT
>probe:Drosophila_2:1640235_at:360:709; Interrogation_Position=3755; Antisense; TTAAATGTCTATGAACCCGTGTATT
>probe:Drosophila_2:1640235_at:443:379; Interrogation_Position=3767; Antisense; GAACCCGTGTATTTCGCATATTATA

Paste this into a BLAST search page for me
AGGAATCATCCTTGCTTTATCCCCTTTATCCCCTGCTTATTGCTAATTAGTTAGTTTTCACAATGATCTCGGTAATGATCTCGGTAAAGTTTTGTGGCCTAGTTTTGTGGCCTTGCGCCCAAAAGTTGCGCCCAAAAGTCGTACAGATTTGTCGTACAGATTTTTGGTTTGCCATTGGTTTGCCATAAATACTCGAACAAGACCCAATGCTACTTAATCCGTTTTAAGTATCTTTACTCGACCTTGTATAGACCTTGTATATAGCGCAGTTCGAAGAATCACAGAATCAAATGCCATTTTTTAAATGTCTATGAACCCGTGTATTGAACCCGTGTATTTCGCATATTATA

Full Affymetrix probeset data:

Annotations for 1640235_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720