FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640239_at:

>probe:Drosophila_2:1640239_at:299:449; Interrogation_Position=3568; Antisense; GATCCCCTGATCAAGACCGTAATTA
>probe:Drosophila_2:1640239_at:699:185; Interrogation_Position=3592; Antisense; AACAATTGGCTCGAGCATCTGGAGG
>probe:Drosophila_2:1640239_at:559:555; Interrogation_Position=3617; Antisense; GGACGGGTAACTTTGCAGCAGCAGC
>probe:Drosophila_2:1640239_at:490:281; Interrogation_Position=3641; Antisense; CTCTGATCTGCGTTCTGGACAATGA
>probe:Drosophila_2:1640239_at:175:51; Interrogation_Position=3667; Antisense; ATGCTGCGTGGATACTCCTATCTAA
>probe:Drosophila_2:1640239_at:651:671; Interrogation_Position=3697; Antisense; TACCGCAACTGCACTCCGGAAATTG
>probe:Drosophila_2:1640239_at:317:287; Interrogation_Position=3713; Antisense; CGGAAATTGCCGATCTTATGGACCA
>probe:Drosophila_2:1640239_at:76:35; Interrogation_Position=3739; Antisense; ATCAAACGGATTGGCCAGCTGGGCG
>probe:Drosophila_2:1640239_at:374:327; Interrogation_Position=3764; Antisense; GCGTTCTAGATGGTTGTGCTCCCAA
>probe:Drosophila_2:1640239_at:295:299; Interrogation_Position=3784; Antisense; CCCAATGAGCCGATCCACAATGGAT
>probe:Drosophila_2:1640239_at:274:451; Interrogation_Position=3806; Antisense; GATCTACTGCCGAGCATTAAGCCTT
>probe:Drosophila_2:1640239_at:261:327; Interrogation_Position=3849; Antisense; GCGTACTTTTAGCTGAAACTGGCTG
>probe:Drosophila_2:1640239_at:39:197; Interrogation_Position=3865; Antisense; AACTGGCTGTACTAGTGTAACTCAT
>probe:Drosophila_2:1640239_at:32:433; Interrogation_Position=3998; Antisense; GAGTCGCCTTTGCTATACTTTTATT

Paste this into a BLAST search page for me
GATCCCCTGATCAAGACCGTAATTAAACAATTGGCTCGAGCATCTGGAGGGGACGGGTAACTTTGCAGCAGCAGCCTCTGATCTGCGTTCTGGACAATGAATGCTGCGTGGATACTCCTATCTAATACCGCAACTGCACTCCGGAAATTGCGGAAATTGCCGATCTTATGGACCAATCAAACGGATTGGCCAGCTGGGCGGCGTTCTAGATGGTTGTGCTCCCAACCCAATGAGCCGATCCACAATGGATGATCTACTGCCGAGCATTAAGCCTTGCGTACTTTTAGCTGAAACTGGCTGAACTGGCTGTACTAGTGTAACTCATGAGTCGCCTTTGCTATACTTTTATT

Full Affymetrix probeset data:

Annotations for 1640239_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720