Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640241_at:

>probe:Drosophila_2:1640241_at:171:325; Interrogation_Position=2597; Antisense; GCGAAAAGCCCTACGCTACGGAGTA
>probe:Drosophila_2:1640241_at:233:667; Interrogation_Position=2613; Antisense; TACGGAGTATGCTTTGGCCTTAGTC
>probe:Drosophila_2:1640241_at:8:321; Interrogation_Position=2638; Antisense; GCCCTGCCAACTGACAACGAAGATA
>probe:Drosophila_2:1640241_at:215:71; Interrogation_Position=2663; Antisense; AGGAAGAAGCCTTGCGTGCCTTTTC
>probe:Drosophila_2:1640241_at:141:171; Interrogation_Position=2730; Antisense; AAAGGTGACTGGGTCGCCGAACTTG
>probe:Drosophila_2:1640241_at:597:279; Interrogation_Position=2759; Antisense; CTCTTCGCGATCCAACTACTAAAGT
>probe:Drosophila_2:1640241_at:182:173; Interrogation_Position=2793; Antisense; AAAGCAGCTTGTAGCCGAGGGCCTT
>probe:Drosophila_2:1640241_at:632:293; Interrogation_Position=2808; Antisense; CGAGGGCCTTGTTCTGGCCGAACAG
>probe:Drosophila_2:1640241_at:404:679; Interrogation_Position=2858; Antisense; TAGTGGACCAGTACAAAGCCGCGCA
>probe:Drosophila_2:1640241_at:47:347; Interrogation_Position=2901; Antisense; GCATCTGGCCATCTGGAAGTACGGT
>probe:Drosophila_2:1640241_at:77:51; Interrogation_Position=2942; Antisense; ATGCGCCCGAGTTCCGCTAAAAGAT
>probe:Drosophila_2:1640241_at:355:291; Interrogation_Position=2994; Antisense; CGTGGAGCGCGTTGCTAGCCGAAAA
>probe:Drosophila_2:1640241_at:511:387; Interrogation_Position=3014; Antisense; GAAAAGATTGTCTGCCACATACCCG
>probe:Drosophila_2:1640241_at:621:151; Interrogation_Position=3030; Antisense; ACATACCCGCCCTTTATATACATAA

Paste this into a BLAST search page for me
GCGAAAAGCCCTACGCTACGGAGTATACGGAGTATGCTTTGGCCTTAGTCGCCCTGCCAACTGACAACGAAGATAAGGAAGAAGCCTTGCGTGCCTTTTCAAAGGTGACTGGGTCGCCGAACTTGCTCTTCGCGATCCAACTACTAAAGTAAAGCAGCTTGTAGCCGAGGGCCTTCGAGGGCCTTGTTCTGGCCGAACAGTAGTGGACCAGTACAAAGCCGCGCAGCATCTGGCCATCTGGAAGTACGGTATGCGCCCGAGTTCCGCTAAAAGATCGTGGAGCGCGTTGCTAGCCGAAAAGAAAAGATTGTCTGCCACATACCCGACATACCCGCCCTTTATATACATAA

Full Affymetrix probeset data:

Annotations for 1640241_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime