FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640243_at:

>probe:Drosophila_2:1640243_at:285:585; Interrogation_Position=1042; Antisense; TGGAAATGCCTAATCCCTGGAACAT
>probe:Drosophila_2:1640243_at:230:305; Interrogation_Position=1069; Antisense; CCTTTGACATGGTTCTCTTCCTAAA
>probe:Drosophila_2:1640243_at:203:279; Interrogation_Position=1101; Antisense; CTAATGCTGCTGATCATACCGGGCA
>probe:Drosophila_2:1640243_at:390:353; Interrogation_Position=1123; Antisense; GCAGCTACCTAGTTATGTCGCACAT
>probe:Drosophila_2:1640243_at:397:353; Interrogation_Position=1142; Antisense; GCACATGGCCAAGCTTAGGTCCAAA
>probe:Drosophila_2:1640243_at:35:107; Interrogation_Position=1221; Antisense; AGACACTGCCCGGATCATGACAGTA
>probe:Drosophila_2:1640243_at:502:399; Interrogation_Position=1239; Antisense; GACAGTACGATTTCCTATTTTCTTT
>probe:Drosophila_2:1640243_at:573:59; Interrogation_Position=819; Antisense; ATGTATGCCAAACCCGTCGTTTTCT
>probe:Drosophila_2:1640243_at:18:23; Interrogation_Position=855; Antisense; ATATGGTCTCTGGTCGAATTGGTGC
>probe:Drosophila_2:1640243_at:62:535; Interrogation_Position=875; Antisense; GGTGCGATATCCATACTACTTGGCT
>probe:Drosophila_2:1640243_at:310:427; Interrogation_Position=938; Antisense; GAGATACACCATCTGGATACCGCTC
>probe:Drosophila_2:1640243_at:223:65; Interrogation_Position=969; Antisense; ATGGGCATCCTTTGCGAGGGCATTA
>probe:Drosophila_2:1640243_at:189:435; Interrogation_Position=984; Antisense; GAGGGCATTATCGTATTGCGCAATA
>probe:Drosophila_2:1640243_at:437:721; Interrogation_Position=999; Antisense; TTGCGCAATATTCCCTACATCGAAG

Paste this into a BLAST search page for me
TGGAAATGCCTAATCCCTGGAACATCCTTTGACATGGTTCTCTTCCTAAACTAATGCTGCTGATCATACCGGGCAGCAGCTACCTAGTTATGTCGCACATGCACATGGCCAAGCTTAGGTCCAAAAGACACTGCCCGGATCATGACAGTAGACAGTACGATTTCCTATTTTCTTTATGTATGCCAAACCCGTCGTTTTCTATATGGTCTCTGGTCGAATTGGTGCGGTGCGATATCCATACTACTTGGCTGAGATACACCATCTGGATACCGCTCATGGGCATCCTTTGCGAGGGCATTAGAGGGCATTATCGTATTGCGCAATATTGCGCAATATTCCCTACATCGAAG

Full Affymetrix probeset data:

Annotations for 1640243_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720