FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640244_at:

>probe:Drosophila_2:1640244_at:442:211; Interrogation_Position=115; Antisense; AAGACATGGATCGAGCAGCAGCCGC
>probe:Drosophila_2:1640244_at:274:125; Interrogation_Position=134; Antisense; AGCCGCATCTAAATCCCCGAATGGA
>probe:Drosophila_2:1640244_at:489:451; Interrogation_Position=160; Antisense; GATCAGTTTCTGGTGGCTTTCTTGC
>probe:Drosophila_2:1640244_at:483:697; Interrogation_Position=177; Antisense; TTTCTTGCGCGGCTGCAAGTACAGT
>probe:Drosophila_2:1640244_at:706:615; Interrogation_Position=190; Antisense; TGCAAGTACAGTTTGGAGCGGGCCA
>probe:Drosophila_2:1640244_at:637:453; Interrogation_Position=226; Antisense; GATAAGTACTACACGCTGAAGACCA
>probe:Drosophila_2:1640244_at:576:367; Interrogation_Position=243; Antisense; GAAGACCAAGTATCCGGACTATTTC
>probe:Drosophila_2:1640244_at:563:399; Interrogation_Position=259; Antisense; GACTATTTCCGAGTTACCAACACCA
>probe:Drosophila_2:1640244_at:577:475; Interrogation_Position=271; Antisense; GTTACCAACACCACGGATAGCAAGT
>probe:Drosophila_2:1640244_at:317:505; Interrogation_Position=29; Antisense; GTCCACTTACGCCAGAGCTGCAAAA
>probe:Drosophila_2:1640244_at:64:361; Interrogation_Position=290; Antisense; GCAAGTTCCGGGAGATTCATCAAAC
>probe:Drosophila_2:1640244_at:583:221; Interrogation_Position=73; Antisense; AAGGAGGATCCCGAACGTCTCGAAG
>probe:Drosophila_2:1640244_at:198:383; Interrogation_Position=85; Antisense; GAACGTCTCGAAGCCGATCTGCAGG
>probe:Drosophila_2:1640244_at:194:125; Interrogation_Position=96; Antisense; AGCCGATCTGCAGGCGTTTAAGACA

Paste this into a BLAST search page for me
AAGACATGGATCGAGCAGCAGCCGCAGCCGCATCTAAATCCCCGAATGGAGATCAGTTTCTGGTGGCTTTCTTGCTTTCTTGCGCGGCTGCAAGTACAGTTGCAAGTACAGTTTGGAGCGGGCCAGATAAGTACTACACGCTGAAGACCAGAAGACCAAGTATCCGGACTATTTCGACTATTTCCGAGTTACCAACACCAGTTACCAACACCACGGATAGCAAGTGTCCACTTACGCCAGAGCTGCAAAAGCAAGTTCCGGGAGATTCATCAAACAAGGAGGATCCCGAACGTCTCGAAGGAACGTCTCGAAGCCGATCTGCAGGAGCCGATCTGCAGGCGTTTAAGACA

Full Affymetrix probeset data:

Annotations for 1640244_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720