Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640246_at:

>probe:Drosophila_2:1640246_at:350:23; Interrogation_Position=105; Antisense; ATATCGCGATCAGCACTTCAAGGGC
>probe:Drosophila_2:1640246_at:242:311; Interrogation_Position=158; Antisense; GCGACTCGTGTACACTTTACGTGGG
>probe:Drosophila_2:1640246_at:370:525; Interrogation_Position=180; Antisense; GGGAAACTTGAGCTTCTACACCACC
>probe:Drosophila_2:1640246_at:481:437; Interrogation_Position=205; Antisense; GAGGAGCAGATCCACGAGCTCTTCT
>probe:Drosophila_2:1640246_at:717:59; Interrogation_Position=242; Antisense; ATGTTCGTGTGATTGTGATGGGCCT
>probe:Drosophila_2:1640246_at:554:217; Interrogation_Position=271; Antisense; AAGTATAAGAAGACGCCCTGCGGCT
>probe:Drosophila_2:1640246_at:524:331; Interrogation_Position=290; Antisense; GCGGCTTCTGCTTCGTGGAGTACTA
>probe:Drosophila_2:1640246_at:290:587; Interrogation_Position=305; Antisense; TGGAGTACTATGTCCGATCGGAGGC
>probe:Drosophila_2:1640246_at:185:597; Interrogation_Position=348; Antisense; TGTGAATGGCACTCGCTTGGACGAC
>probe:Drosophila_2:1640246_at:524:545; Interrogation_Position=366; Antisense; GGACGACCGTCTGATTCGTGTGGAC
>probe:Drosophila_2:1640246_at:209:349; Interrogation_Position=413; Antisense; GCAGGCAGTATGGACGCGGCAAAAC
>probe:Drosophila_2:1640246_at:417:27; Interrogation_Position=459; Antisense; ATACCGCACGGATTACGATGCCGGC
>probe:Drosophila_2:1640246_at:285:375; Interrogation_Position=513; Antisense; GAAGATTGCACCCAACACGGACAAT
>probe:Drosophila_2:1640246_at:333:471; Interrogation_Position=81; Antisense; GTTCGCATCTGTGGAATTAAGCTCA

Paste this into a BLAST search page for me
ATATCGCGATCAGCACTTCAAGGGCGCGACTCGTGTACACTTTACGTGGGGGGAAACTTGAGCTTCTACACCACCGAGGAGCAGATCCACGAGCTCTTCTATGTTCGTGTGATTGTGATGGGCCTAAGTATAAGAAGACGCCCTGCGGCTGCGGCTTCTGCTTCGTGGAGTACTATGGAGTACTATGTCCGATCGGAGGCTGTGAATGGCACTCGCTTGGACGACGGACGACCGTCTGATTCGTGTGGACGCAGGCAGTATGGACGCGGCAAAACATACCGCACGGATTACGATGCCGGCGAAGATTGCACCCAACACGGACAATGTTCGCATCTGTGGAATTAAGCTCA

Full Affymetrix probeset data:

Annotations for 1640246_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime