Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640247_at:

>probe:Drosophila_2:1640247_at:157:391; Interrogation_Position=1168; Antisense; GAAACTCTCAATCGCACCAAGCAGG
>probe:Drosophila_2:1640247_at:87:449; Interrogation_Position=1219; Antisense; GATGCCATTATAGAGCGCCTCGAGC
>probe:Drosophila_2:1640247_at:388:215; Interrogation_Position=1316; Antisense; AAGATCTTGAGAGCGCCGAGGCCAT
>probe:Drosophila_2:1640247_at:621:311; Interrogation_Position=1371; Antisense; GCCACTTTACCGACAGTTACTCAAT
>probe:Drosophila_2:1640247_at:262:475; Interrogation_Position=1386; Antisense; GTTACTCAATGCCTATGCCGACGAA
>probe:Drosophila_2:1640247_at:317:313; Interrogation_Position=1414; Antisense; GCCACCGAGGATGCCATATATTACT
>probe:Drosophila_2:1640247_at:353:273; Interrogation_Position=1428; Antisense; CATATATTACTTGGGCGAGGGTCTC
>probe:Drosophila_2:1640247_at:299:513; Interrogation_Position=1460; Antisense; GTGTCATCGATCTGGAGACCTTTCT
>probe:Drosophila_2:1640247_at:601:103; Interrogation_Position=1475; Antisense; AGACCTTTCTTAAGCACGTGCGACA
>probe:Drosophila_2:1640247_at:616:389; Interrogation_Position=1547; Antisense; GACAAAAGGCCGGTCTAGCGGGCTA
>probe:Drosophila_2:1640247_at:447:415; Interrogation_Position=1575; Antisense; GAGCCATGATTTCAACAGTTGCCGT
>probe:Drosophila_2:1640247_at:700:263; Interrogation_Position=1590; Antisense; CAGTTGCCGTGATTTCTTATTCGAC
>probe:Drosophila_2:1640247_at:82:679; Interrogation_Position=1619; Antisense; TAGTGCGAGCACGTGCAGACGATTT
>probe:Drosophila_2:1640247_at:665:303; Interrogation_Position=1738; Antisense; GCCTCATGTATGTTAACGCCCACGA

Paste this into a BLAST search page for me
GAAACTCTCAATCGCACCAAGCAGGGATGCCATTATAGAGCGCCTCGAGCAAGATCTTGAGAGCGCCGAGGCCATGCCACTTTACCGACAGTTACTCAATGTTACTCAATGCCTATGCCGACGAAGCCACCGAGGATGCCATATATTACTCATATATTACTTGGGCGAGGGTCTCGTGTCATCGATCTGGAGACCTTTCTAGACCTTTCTTAAGCACGTGCGACAGACAAAAGGCCGGTCTAGCGGGCTAGAGCCATGATTTCAACAGTTGCCGTCAGTTGCCGTGATTTCTTATTCGACTAGTGCGAGCACGTGCAGACGATTTGCCTCATGTATGTTAACGCCCACGA

Full Affymetrix probeset data:

Annotations for 1640247_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime