Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640251_s_at:

>probe:Drosophila_2:1640251_s_at:35:475; Interrogation_Position=1043; Antisense; GTTAAGAATTCAGTCCTCAGCTTTG
>probe:Drosophila_2:1640251_s_at:323:643; Interrogation_Position=1052; Antisense; TCAGTCCTCAGCTTTGAACGAAATT
>probe:Drosophila_2:1640251_s_at:337:263; Interrogation_Position=488; Antisense; CAGACCGCGTGGTGCGCGCCAAGCT
>probe:Drosophila_2:1640251_s_at:558:121; Interrogation_Position=520; Antisense; AGCGGAGTGCACTGCATGAAGACAA
>probe:Drosophila_2:1640251_s_at:429:617; Interrogation_Position=532; Antisense; TGCATGAAGACAACACAAGCCGTGA
>probe:Drosophila_2:1640251_s_at:587:159; Interrogation_Position=546; Antisense; ACAAGCCGTGATCGTTTCCATCTAC
>probe:Drosophila_2:1640251_s_at:123:435; Interrogation_Position=571; Antisense; GAGGATCCCGTTCAGCCCCAGCAGG
>probe:Drosophila_2:1640251_s_at:638:61; Interrogation_Position=593; Antisense; AGGCCGCTTCCGTGGTAGAGAAACT
>probe:Drosophila_2:1640251_s_at:399:461; Interrogation_Position=622; Antisense; GATTATCTGATTACTTGCGGGTACT
>probe:Drosophila_2:1640251_s_at:535:421; Interrogation_Position=649; Antisense; GAGAATAGATCAACACAAACACCCC
>probe:Drosophila_2:1640251_s_at:400:255; Interrogation_Position=739; Antisense; CAAATTTGATAAGAGCGAACCGTAA
>probe:Drosophila_2:1640251_s_at:224:253; Interrogation_Position=824; Antisense; CAACGGCCAAGAAAGAATTTGCGGT
>probe:Drosophila_2:1640251_s_at:31:291; Interrogation_Position=845; Antisense; CGGTTTTTTGTGTGTAGCAGAGGAA
>probe:Drosophila_2:1640251_s_at:289:451; Interrogation_Position=873; Antisense; GATCGAGTAAAAATGCATATGCTTG

Paste this into a BLAST search page for me
GTTAAGAATTCAGTCCTCAGCTTTGTCAGTCCTCAGCTTTGAACGAAATTCAGACCGCGTGGTGCGCGCCAAGCTAGCGGAGTGCACTGCATGAAGACAATGCATGAAGACAACACAAGCCGTGAACAAGCCGTGATCGTTTCCATCTACGAGGATCCCGTTCAGCCCCAGCAGGAGGCCGCTTCCGTGGTAGAGAAACTGATTATCTGATTACTTGCGGGTACTGAGAATAGATCAACACAAACACCCCCAAATTTGATAAGAGCGAACCGTAACAACGGCCAAGAAAGAATTTGCGGTCGGTTTTTTGTGTGTAGCAGAGGAAGATCGAGTAAAAATGCATATGCTTG

Full Affymetrix probeset data:

Annotations for 1640251_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime