Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640252_at:

>probe:Drosophila_2:1640252_at:331:183; Interrogation_Position=214; Antisense; AAAAGCGGCCCAACATCGAGGTGGT
>probe:Drosophila_2:1640252_at:635:339; Interrogation_Position=239; Antisense; GCTAAAGACCTTCGTCGAGGGCGTT
>probe:Drosophila_2:1640252_at:603:533; Interrogation_Position=281; Antisense; GGTGTCAATGAAGCCGCACTTTGTC
>probe:Drosophila_2:1640252_at:45:693; Interrogation_Position=300; Antisense; TTTGTCTACAATAAGCTCCTGCTGC
>probe:Drosophila_2:1640252_at:487:123; Interrogation_Position=421; Antisense; AGCGCACGGTCAACATGCTGGAGAC
>probe:Drosophila_2:1640252_at:259:3; Interrogation_Position=447; Antisense; ATTGTGCTGGCGGTGGTCATGAACA
>probe:Drosophila_2:1640252_at:271:635; Interrogation_Position=513; Antisense; TCGCTGCGCAAGACTGGGTTCTATT
>probe:Drosophila_2:1640252_at:256:77; Interrogation_Position=544; Antisense; AGGAGTGCATTACCCTGCCCAAGGA
>probe:Drosophila_2:1640252_at:527:161; Interrogation_Position=601; Antisense; ACAAGGACTTCTACTGCACTGTGAC
>probe:Drosophila_2:1640252_at:663:159; Interrogation_Position=631; Antisense; ACAAGCTGGAACAGGCGCGACTCAA
>probe:Drosophila_2:1640252_at:534:221; Interrogation_Position=654; Antisense; AAGTGTCGTCTGCACCACTGGAGCA
>probe:Drosophila_2:1640252_at:648:315; Interrogation_Position=698; Antisense; GCCTTACGTACTCGAGCACTGGAAA
>probe:Drosophila_2:1640252_at:631:277; Interrogation_Position=738; Antisense; CTGCTGGATGTATGTTCACCCGAAA
>probe:Drosophila_2:1640252_at:148:425; Interrogation_Position=773; Antisense; GAGACCCCATACCAAATACATGCGA

Paste this into a BLAST search page for me
AAAAGCGGCCCAACATCGAGGTGGTGCTAAAGACCTTCGTCGAGGGCGTTGGTGTCAATGAAGCCGCACTTTGTCTTTGTCTACAATAAGCTCCTGCTGCAGCGCACGGTCAACATGCTGGAGACATTGTGCTGGCGGTGGTCATGAACATCGCTGCGCAAGACTGGGTTCTATTAGGAGTGCATTACCCTGCCCAAGGAACAAGGACTTCTACTGCACTGTGACACAAGCTGGAACAGGCGCGACTCAAAAGTGTCGTCTGCACCACTGGAGCAGCCTTACGTACTCGAGCACTGGAAACTGCTGGATGTATGTTCACCCGAAAGAGACCCCATACCAAATACATGCGA

Full Affymetrix probeset data:

Annotations for 1640252_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime