FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640257_at:

>probe:Drosophila_2:1640257_at:710:133; Interrogation_Position=1257; Antisense; ACGAGCCTTCTTCTTTAACGGGCAG
>probe:Drosophila_2:1640257_at:429:29; Interrogation_Position=1304; Antisense; ATAACCTGGTGGACCTGTTCTCCGA
>probe:Drosophila_2:1640257_at:338:603; Interrogation_Position=1319; Antisense; TGTTCTCCGACTATCATTTCAGCAT
>probe:Drosophila_2:1640257_at:514:17; Interrogation_Position=1334; Antisense; ATTTCAGCATGGATCTGCAGCGCGC
>probe:Drosophila_2:1640257_at:496:83; Interrogation_Position=1359; Antisense; AGTGGAGATTCACGCTAGCTGCCAA
>probe:Drosophila_2:1640257_at:297:175; Interrogation_Position=1382; Antisense; AAACGCAATCTCCTCTGTACTTCTA
>probe:Drosophila_2:1640257_at:367:489; Interrogation_Position=1398; Antisense; GTACTTCTATCGCTTGGACTATGTG
>probe:Drosophila_2:1640257_at:327:63; Interrogation_Position=1418; Antisense; ATGTGGGCGGTCGTAATCTGTACAA
>probe:Drosophila_2:1640257_at:412:213; Interrogation_Position=1460; Antisense; AAGACCTGCGTGGAGTGGCTCATGC
>probe:Drosophila_2:1640257_at:12:445; Interrogation_Position=1486; Antisense; GATGATATTTGCTACCTGTTCCAGA
>probe:Drosophila_2:1640257_at:421:401; Interrogation_Position=1543; Antisense; GACTTGATGGTCACGGAACGGCTAT
>probe:Drosophila_2:1640257_at:644:325; Interrogation_Position=1592; Antisense; GCGATGGAAAACCTTCGCCCATTTG
>probe:Drosophila_2:1640257_at:222:405; Interrogation_Position=1660; Antisense; GACTGCCTGCTAATCGATCGGGAGC
>probe:Drosophila_2:1640257_at:152:443; Interrogation_Position=1689; Antisense; GATGTGCAGCAATCCGGATGGCGAA

Paste this into a BLAST search page for me
ACGAGCCTTCTTCTTTAACGGGCAGATAACCTGGTGGACCTGTTCTCCGATGTTCTCCGACTATCATTTCAGCATATTTCAGCATGGATCTGCAGCGCGCAGTGGAGATTCACGCTAGCTGCCAAAAACGCAATCTCCTCTGTACTTCTAGTACTTCTATCGCTTGGACTATGTGATGTGGGCGGTCGTAATCTGTACAAAAGACCTGCGTGGAGTGGCTCATGCGATGATATTTGCTACCTGTTCCAGAGACTTGATGGTCACGGAACGGCTATGCGATGGAAAACCTTCGCCCATTTGGACTGCCTGCTAATCGATCGGGAGCGATGTGCAGCAATCCGGATGGCGAA

Full Affymetrix probeset data:

Annotations for 1640257_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720