Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640260_at:

>probe:Drosophila_2:1640260_at:408:553; Interrogation_Position=2016; Antisense; GGAGCTCTGCTGAACAACGTCTTTG
>probe:Drosophila_2:1640260_at:609:197; Interrogation_Position=2031; Antisense; AACGTCTTTGCGGTGCACATTGATA
>probe:Drosophila_2:1640260_at:703:509; Interrogation_Position=2066; Antisense; GTGCAACATCTTTAAGCGACCATTT
>probe:Drosophila_2:1640260_at:644:413; Interrogation_Position=2083; Antisense; GACCATTTGCAAGGCGCGCCAAGAA
>probe:Drosophila_2:1640260_at:527:281; Interrogation_Position=2139; Antisense; CTCTCAGTGATGTCGTTGCTTAGCA
>probe:Drosophila_2:1640260_at:169:231; Interrogation_Position=2190; Antisense; AATGTCAAGGACTTCTTCTCTCACT
>probe:Drosophila_2:1640260_at:227:505; Interrogation_Position=2226; Antisense; GTGCCGGATCTTTCGTTCGTAATCT
>probe:Drosophila_2:1640260_at:493:655; Interrogation_Position=2245; Antisense; TAATCTTCGAACACTTGCTGCTGGG
>probe:Drosophila_2:1640260_at:381:595; Interrogation_Position=2266; Antisense; TGGGCCTGAAGTTTCTCATCCACAA
>probe:Drosophila_2:1640260_at:193:541; Interrogation_Position=2291; Antisense; GGTTATTCACGAAAGGCCGCGCTGG
>probe:Drosophila_2:1640260_at:49:333; Interrogation_Position=2311; Antisense; GCTGGGTGCGCATCGGACTGCTAAA
>probe:Drosophila_2:1640260_at:246:169; Interrogation_Position=2333; Antisense; AAAGGCGGACTTCGAGACCAGCCAG
>probe:Drosophila_2:1640260_at:709:125; Interrogation_Position=2352; Antisense; AGCCAGGCTCTCAAGCAACTCAAAA
>probe:Drosophila_2:1640260_at:386:145; Interrogation_Position=2435; Antisense; ACTCCACTCCTTTTGGTGCTAATGA

Paste this into a BLAST search page for me
GGAGCTCTGCTGAACAACGTCTTTGAACGTCTTTGCGGTGCACATTGATAGTGCAACATCTTTAAGCGACCATTTGACCATTTGCAAGGCGCGCCAAGAACTCTCAGTGATGTCGTTGCTTAGCAAATGTCAAGGACTTCTTCTCTCACTGTGCCGGATCTTTCGTTCGTAATCTTAATCTTCGAACACTTGCTGCTGGGTGGGCCTGAAGTTTCTCATCCACAAGGTTATTCACGAAAGGCCGCGCTGGGCTGGGTGCGCATCGGACTGCTAAAAAAGGCGGACTTCGAGACCAGCCAGAGCCAGGCTCTCAAGCAACTCAAAAACTCCACTCCTTTTGGTGCTAATGA

Full Affymetrix probeset data:

Annotations for 1640260_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime