Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640261_at:

>probe:Drosophila_2:1640261_at:396:317; Interrogation_Position=1604; Antisense; GCCGGTGCCAGGTTGTGAGAACTAC
>probe:Drosophila_2:1640261_at:320:609; Interrogation_Position=1619; Antisense; TGAGAACTACGAATTCGCCTCGGAT
>probe:Drosophila_2:1640261_at:459:279; Interrogation_Position=1625; Antisense; CTACGAATTCGCCTCGGATGATTAT
>probe:Drosophila_2:1640261_at:636:333; Interrogation_Position=1860; Antisense; GCTGATATGATACGATCCGAATGGA
>probe:Drosophila_2:1640261_at:379:455; Interrogation_Position=1868; Antisense; GATACGATCCGAATGGAGTTGATTA
>probe:Drosophila_2:1640261_at:698:89; Interrogation_Position=1884; Antisense; AGTTGATTAACTCCAGATGAAGATC
>probe:Drosophila_2:1640261_at:329:445; Interrogation_Position=1899; Antisense; GATGAAGATCACCAAATCAGCGATT
>probe:Drosophila_2:1640261_at:91:455; Interrogation_Position=1905; Antisense; GATCACCAAATCAGCGATTTATGTA
>probe:Drosophila_2:1640261_at:218:357; Interrogation_Position=1969; Antisense; GCAAACGGGTAAAATCGTCACACGT
>probe:Drosophila_2:1640261_at:130:233; Interrogation_Position=1981; Antisense; AATCGTCACACGTTAAAAGCATTCG
>probe:Drosophila_2:1640261_at:540:129; Interrogation_Position=1988; Antisense; ACACGTTAAAAGCATTCGACAATTC
>probe:Drosophila_2:1640261_at:691:465; Interrogation_Position=2028; Antisense; GATTGTGTTCCATACATAATTTTAA
>probe:Drosophila_2:1640261_at:578:29; Interrogation_Position=2071; Antisense; ATCACATTTTCATTGGATTTTAAAG
>probe:Drosophila_2:1640261_at:253:653; Interrogation_Position=2177; Antisense; TAATAAATGCCATCGAAAATCTTTA

Paste this into a BLAST search page for me
GCCGGTGCCAGGTTGTGAGAACTACTGAGAACTACGAATTCGCCTCGGATCTACGAATTCGCCTCGGATGATTATGCTGATATGATACGATCCGAATGGAGATACGATCCGAATGGAGTTGATTAAGTTGATTAACTCCAGATGAAGATCGATGAAGATCACCAAATCAGCGATTGATCACCAAATCAGCGATTTATGTAGCAAACGGGTAAAATCGTCACACGTAATCGTCACACGTTAAAAGCATTCGACACGTTAAAAGCATTCGACAATTCGATTGTGTTCCATACATAATTTTAAATCACATTTTCATTGGATTTTAAAGTAATAAATGCCATCGAAAATCTTTA

Full Affymetrix probeset data:

Annotations for 1640261_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime