FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640263_at:

>probe:Drosophila_2:1640263_at:141:615; Interrogation_Position=153; Antisense; TGAAGAAGGCCTTCACCGAGATGCA
>probe:Drosophila_2:1640263_at:2:425; Interrogation_Position=191; Antisense; GAGACGACCAAGAAGATCCACATGA
>probe:Drosophila_2:1640263_at:335:183; Interrogation_Position=270; Antisense; AAAAGGGCACCAGCAGCTTGGCCGA
>probe:Drosophila_2:1640263_at:675:717; Interrogation_Position=287; Antisense; TTGGCCGACGACACAAGAGTTTACC
>probe:Drosophila_2:1640263_at:86:175; Interrogation_Position=30; Antisense; AAACCATAAGCTTACCGCAGGTGTT
>probe:Drosophila_2:1640263_at:145:99; Interrogation_Position=302; Antisense; AGAGTTTACCAGTCCGTGGGTCGCA
>probe:Drosophila_2:1640263_at:653:59; Interrogation_Position=326; Antisense; ATGTTCCTGCTTACCGATGTACAGA
>probe:Drosophila_2:1640263_at:76:243; Interrogation_Position=350; Antisense; AATATGCGCGAGGACCTGAAGGCTA
>probe:Drosophila_2:1640263_at:293:351; Interrogation_Position=430; Antisense; GCAGAAGTCCCTTAAGAGCCAGGAA
>probe:Drosophila_2:1640263_at:20:299; Interrogation_Position=45; Antisense; CGCAGGTGTTGCAATTTTCAGTGAA
>probe:Drosophila_2:1640263_at:328:251; Interrogation_Position=484; Antisense; CAAGGAAGCCGATCAGACTGCGAAA
>probe:Drosophila_2:1640263_at:485:241; Interrogation_Position=507; Antisense; AATAGACTACAACTCCAAACTGGCA
>probe:Drosophila_2:1640263_at:630:17; Interrogation_Position=531; Antisense; ATTTATCCCTCAACGCAATTGCTTA
>probe:Drosophila_2:1640263_at:423:615; Interrogation_Position=66; Antisense; TGAATTCGCAGCAAAGCCAAGCAAT

Paste this into a BLAST search page for me
TGAAGAAGGCCTTCACCGAGATGCAGAGACGACCAAGAAGATCCACATGAAAAAGGGCACCAGCAGCTTGGCCGATTGGCCGACGACACAAGAGTTTACCAAACCATAAGCTTACCGCAGGTGTTAGAGTTTACCAGTCCGTGGGTCGCAATGTTCCTGCTTACCGATGTACAGAAATATGCGCGAGGACCTGAAGGCTAGCAGAAGTCCCTTAAGAGCCAGGAACGCAGGTGTTGCAATTTTCAGTGAACAAGGAAGCCGATCAGACTGCGAAAAATAGACTACAACTCCAAACTGGCAATTTATCCCTCAACGCAATTGCTTATGAATTCGCAGCAAAGCCAAGCAAT

Full Affymetrix probeset data:

Annotations for 1640263_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720