FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640264_at:

>probe:Drosophila_2:1640264_at:685:31; Interrogation_Position=1965; Antisense; ATCACTTGGGACAACCGTTGCCCAA
>probe:Drosophila_2:1640264_at:730:469; Interrogation_Position=1981; Antisense; GTTGCCCAATCTTTTGGTGCAGCAC
>probe:Drosophila_2:1640264_at:397:575; Interrogation_Position=2011; Antisense; GGCGCCATCGCACATGGAGCAGCAT
>probe:Drosophila_2:1640264_at:712:113; Interrogation_Position=2028; Antisense; AGCAGCATGGCAGCTCGGCGAGCCT
>probe:Drosophila_2:1640264_at:597:575; Interrogation_Position=2044; Antisense; GGCGAGCCTCTTGCATAATCCAAAT
>probe:Drosophila_2:1640264_at:74:657; Interrogation_Position=2059; Antisense; TAATCCAAATCTGATGCACCTGCAG
>probe:Drosophila_2:1640264_at:450:545; Interrogation_Position=2183; Antisense; GGATCGGGAGCAGTGCTTCTCTCGC
>probe:Drosophila_2:1640264_at:32:347; Interrogation_Position=2212; Antisense; GCATCTTCAGCAAAGTCCGCAATCG
>probe:Drosophila_2:1640264_at:34:235; Interrogation_Position=2232; Antisense; AATCGAATCGGAGCAGTCATTCCCT
>probe:Drosophila_2:1640264_at:231:101; Interrogation_Position=2265; Antisense; AGAGTCCACCTCCACAGTCAGTGGA
>probe:Drosophila_2:1640264_at:585:413; Interrogation_Position=2331; Antisense; GAGCCACCACTGAGGTTACCACGGA
>probe:Drosophila_2:1640264_at:250:157; Interrogation_Position=2400; Antisense; ACACCAGGCACACCTTCAAGATGGA
>probe:Drosophila_2:1640264_at:352:587; Interrogation_Position=2421; Antisense; TGGAGAACATGTAAGGCTGTCGCCG
>probe:Drosophila_2:1640264_at:344:149; Interrogation_Position=2458; Antisense; ACATCGCACTGCCTCAAAAGCGGAT

Paste this into a BLAST search page for me
ATCACTTGGGACAACCGTTGCCCAAGTTGCCCAATCTTTTGGTGCAGCACGGCGCCATCGCACATGGAGCAGCATAGCAGCATGGCAGCTCGGCGAGCCTGGCGAGCCTCTTGCATAATCCAAATTAATCCAAATCTGATGCACCTGCAGGGATCGGGAGCAGTGCTTCTCTCGCGCATCTTCAGCAAAGTCCGCAATCGAATCGAATCGGAGCAGTCATTCCCTAGAGTCCACCTCCACAGTCAGTGGAGAGCCACCACTGAGGTTACCACGGAACACCAGGCACACCTTCAAGATGGATGGAGAACATGTAAGGCTGTCGCCGACATCGCACTGCCTCAAAAGCGGAT

Full Affymetrix probeset data:

Annotations for 1640264_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720