FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640267_at:

>probe:Drosophila_2:1640267_at:222:141; Interrogation_Position=1446; Antisense; ACGGGAGAGTCCACCGAGAGCGACT
>probe:Drosophila_2:1640267_at:470:417; Interrogation_Position=1463; Antisense; GAGCGACTCCGACTCTGCATATGAA
>probe:Drosophila_2:1640267_at:613:169; Interrogation_Position=1562; Antisense; AAAGGCGGACAACGACTCCAGCTTA
>probe:Drosophila_2:1640267_at:333:425; Interrogation_Position=1587; Antisense; GAGAGCGATGACAGCCTCGGTGAAA
>probe:Drosophila_2:1640267_at:476:511; Interrogation_Position=1606; Antisense; GTGAAAACCATCGTCGTCACCACAG
>probe:Drosophila_2:1640267_at:5:77; Interrogation_Position=1653; Antisense; AGGAGCAAGCATGTCAGGTCCCGCA
>probe:Drosophila_2:1640267_at:91:535; Interrogation_Position=1669; Antisense; GGTCCCGCACGCGATCAAGGTCAAG
>probe:Drosophila_2:1640267_at:34:425; Interrogation_Position=1693; Antisense; GAGACCGTCAGTGATTGATCTATTT
>probe:Drosophila_2:1640267_at:133:469; Interrogation_Position=1742; Antisense; GTTCATTAGACGCTTAAGTTCCTTT
>probe:Drosophila_2:1640267_at:292:167; Interrogation_Position=1822; Antisense; AAATGCCTTGTCTTTTGTTGCGCGT
>probe:Drosophila_2:1640267_at:617:483; Interrogation_Position=1861; Antisense; GTACGCCTCGTTTCGAGAATACTTC
>probe:Drosophila_2:1640267_at:408:365; Interrogation_Position=1877; Antisense; GAATACTTCTGTCTTACATGTTACA
>probe:Drosophila_2:1640267_at:389:521; Interrogation_Position=1925; Antisense; GGGCCAGAACCACGGATTTGCTAGT
>probe:Drosophila_2:1640267_at:646:285; Interrogation_Position=1968; Antisense; CTGTATGCGCTGCTCTTATCTTTTA

Paste this into a BLAST search page for me
ACGGGAGAGTCCACCGAGAGCGACTGAGCGACTCCGACTCTGCATATGAAAAAGGCGGACAACGACTCCAGCTTAGAGAGCGATGACAGCCTCGGTGAAAGTGAAAACCATCGTCGTCACCACAGAGGAGCAAGCATGTCAGGTCCCGCAGGTCCCGCACGCGATCAAGGTCAAGGAGACCGTCAGTGATTGATCTATTTGTTCATTAGACGCTTAAGTTCCTTTAAATGCCTTGTCTTTTGTTGCGCGTGTACGCCTCGTTTCGAGAATACTTCGAATACTTCTGTCTTACATGTTACAGGGCCAGAACCACGGATTTGCTAGTCTGTATGCGCTGCTCTTATCTTTTA

Full Affymetrix probeset data:

Annotations for 1640267_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720