FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640268_at:

>probe:Drosophila_2:1640268_at:408:479; Interrogation_Position=1376; Antisense; GTTTGATTTTTAAGGCTGCACGACA
>probe:Drosophila_2:1640268_at:525:355; Interrogation_Position=1393; Antisense; GCACGACATATAGCACCGATTCAAA
>probe:Drosophila_2:1640268_at:588:329; Interrogation_Position=1431; Antisense; GCGGGATGACAAATTTTTAGCCACA
>probe:Drosophila_2:1640268_at:177:417; Interrogation_Position=1468; Antisense; GAGCCCGCTGGAAGGCTGAACCTAA
>probe:Drosophila_2:1640268_at:302:281; Interrogation_Position=1518; Antisense; CTCATCCAACGAGCACAACTTTGTG
>probe:Drosophila_2:1640268_at:315:727; Interrogation_Position=1538; Antisense; TTGTGTATGTGGGATTGCCTCGCAT
>probe:Drosophila_2:1640268_at:603:525; Interrogation_Position=1566; Antisense; GGGAAAGTGCGTGAACTGCCTAAAA
>probe:Drosophila_2:1640268_at:57:437; Interrogation_Position=1608; Antisense; GAGGAGGATCAATACGCTGTGCAAC
>probe:Drosophila_2:1640268_at:237:673; Interrogation_Position=1620; Antisense; TACGCTGTGCAACACATGTCCTGGA
>probe:Drosophila_2:1640268_at:139:61; Interrogation_Position=1635; Antisense; ATGTCCTGGAAGCAACTGGATGTGC
>probe:Drosophila_2:1640268_at:332:63; Interrogation_Position=1654; Antisense; ATGTGCGAGCCCTGCTTCGAGGAAC
>probe:Drosophila_2:1640268_at:471:715; Interrogation_Position=1669; Antisense; TTCGAGGAACTCCACTCTTGAGTGG
>probe:Drosophila_2:1640268_at:498:15; Interrogation_Position=1789; Antisense; ATTTTGATTTCTGCACTTCGTGGTG
>probe:Drosophila_2:1640268_at:255:519; Interrogation_Position=1808; Antisense; GTGGTGTGTCGTAACCTCTCGAAAA

Paste this into a BLAST search page for me
GTTTGATTTTTAAGGCTGCACGACAGCACGACATATAGCACCGATTCAAAGCGGGATGACAAATTTTTAGCCACAGAGCCCGCTGGAAGGCTGAACCTAACTCATCCAACGAGCACAACTTTGTGTTGTGTATGTGGGATTGCCTCGCATGGGAAAGTGCGTGAACTGCCTAAAAGAGGAGGATCAATACGCTGTGCAACTACGCTGTGCAACACATGTCCTGGAATGTCCTGGAAGCAACTGGATGTGCATGTGCGAGCCCTGCTTCGAGGAACTTCGAGGAACTCCACTCTTGAGTGGATTTTGATTTCTGCACTTCGTGGTGGTGGTGTGTCGTAACCTCTCGAAAA

Full Affymetrix probeset data:

Annotations for 1640268_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720