FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640269_at:

>probe:Drosophila_2:1640269_at:411:447; Interrogation_Position=139; Antisense; GATGCCCGACAAAAGGCCACTGGAT
>probe:Drosophila_2:1640269_at:258:643; Interrogation_Position=180; Antisense; TCTACATTGACCACTGCCGTTATCG
>probe:Drosophila_2:1640269_at:572:317; Interrogation_Position=195; Antisense; GCCGTTATCGTCAAACTTATCGCAA
>probe:Drosophila_2:1640269_at:619:641; Interrogation_Position=256; Antisense; TCTGAGGGCCATTCAGCCAAGGGTT
>probe:Drosophila_2:1640269_at:450:657; Interrogation_Position=291; Antisense; TAAGGATCAACGACAAAGGCCCGCC
>probe:Drosophila_2:1640269_at:45:321; Interrogation_Position=309; Antisense; GCCCGCCCGAAGATGGATCCTTTGA
>probe:Drosophila_2:1640269_at:222:449; Interrogation_Position=324; Antisense; GATCCTTTGAGGTTGCTATTGCTCC
>probe:Drosophila_2:1640269_at:561:689; Interrogation_Position=340; Antisense; TATTGCTCCGCAACCAACCGATGAT
>probe:Drosophila_2:1640269_at:725:717; Interrogation_Position=364; Antisense; TTCCACGGCCCGTCAAAGTGTATGG
>probe:Drosophila_2:1640269_at:548:557; Interrogation_Position=392; Antisense; GGACTAAGGCGGATGCCCAGTGCAT
>probe:Drosophila_2:1640269_at:718:83; Interrogation_Position=410; Antisense; AGTGCATCGAAGGTTCCCCATGTGG
>probe:Drosophila_2:1640269_at:537:151; Interrogation_Position=493; Antisense; ACATCGGCGGATGCTAACCAATTTG
>probe:Drosophila_2:1640269_at:84:615; Interrogation_Position=72; Antisense; TGAAGTCCGTGGTCTGTGGTCCGCC
>probe:Drosophila_2:1640269_at:715:213; Interrogation_Position=98; Antisense; AAGATTTCCACCTGTTTACCTGTGT

Paste this into a BLAST search page for me
GATGCCCGACAAAAGGCCACTGGATTCTACATTGACCACTGCCGTTATCGGCCGTTATCGTCAAACTTATCGCAATCTGAGGGCCATTCAGCCAAGGGTTTAAGGATCAACGACAAAGGCCCGCCGCCCGCCCGAAGATGGATCCTTTGAGATCCTTTGAGGTTGCTATTGCTCCTATTGCTCCGCAACCAACCGATGATTTCCACGGCCCGTCAAAGTGTATGGGGACTAAGGCGGATGCCCAGTGCATAGTGCATCGAAGGTTCCCCATGTGGACATCGGCGGATGCTAACCAATTTGTGAAGTCCGTGGTCTGTGGTCCGCCAAGATTTCCACCTGTTTACCTGTGT

Full Affymetrix probeset data:

Annotations for 1640269_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720