Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640270_at:

>probe:Drosophila_2:1640270_at:160:559; Interrogation_Position=13447; Antisense; GGACAGTTTCGCACTTGGATATCAA
>probe:Drosophila_2:1640270_at:392:49; Interrogation_Position=13495; Antisense; ATGACCGGCTTCTTTAATCCTCAAG
>probe:Drosophila_2:1640270_at:349:661; Interrogation_Position=13526; Antisense; TAACAGCCATGCGACAGTTGCCTAA
>probe:Drosophila_2:1640270_at:392:23; Interrogation_Position=13563; Antisense; ATATGAATACCAAACGCTCTTCGCC
>probe:Drosophila_2:1640270_at:162:339; Interrogation_Position=13578; Antisense; GCTCTTCGCCTTAACTAACCAGAAA
>probe:Drosophila_2:1640270_at:617:179; Interrogation_Position=13616; Antisense; AAAATAGGTCCTTTGTCGTTCGCAT
>probe:Drosophila_2:1640270_at:712:343; Interrogation_Position=13637; Antisense; GCATTGAGGTGACGCGTGCCCACAA
>probe:Drosophila_2:1640270_at:241:141; Interrogation_Position=13738; Antisense; ACGGAGGGCGTCTATGTCCACGGAT
>probe:Drosophila_2:1640270_at:508:223; Interrogation_Position=13822; Antisense; AAGGTGCTCTACGAACAGATGCCCG
>probe:Drosophila_2:1640270_at:605:223; Interrogation_Position=13882; Antisense; AAGGATCCCAAGCTGTACGAGTGCC
>probe:Drosophila_2:1640270_at:669:487; Interrogation_Position=13896; Antisense; GTACGAGTGCCCCATCTATCGGAAA
>probe:Drosophila_2:1640270_at:633:541; Interrogation_Position=13948; Antisense; GGTTCCATTGACTTCGAGACCGAAT
>probe:Drosophila_2:1640270_at:371:425; Interrogation_Position=13963; Antisense; GAGACCGAATTCAATCCCAAGCACT
>probe:Drosophila_2:1640270_at:706:577; Interrogation_Position=14004; Antisense; GGCCCTGCTCTGTGACATCAAGTGA

Paste this into a BLAST search page for me
GGACAGTTTCGCACTTGGATATCAAATGACCGGCTTCTTTAATCCTCAAGTAACAGCCATGCGACAGTTGCCTAAATATGAATACCAAACGCTCTTCGCCGCTCTTCGCCTTAACTAACCAGAAAAAAATAGGTCCTTTGTCGTTCGCATGCATTGAGGTGACGCGTGCCCACAAACGGAGGGCGTCTATGTCCACGGATAAGGTGCTCTACGAACAGATGCCCGAAGGATCCCAAGCTGTACGAGTGCCGTACGAGTGCCCCATCTATCGGAAAGGTTCCATTGACTTCGAGACCGAATGAGACCGAATTCAATCCCAAGCACTGGCCCTGCTCTGTGACATCAAGTGA

Full Affymetrix probeset data:

Annotations for 1640270_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime