FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640275_at:

>probe:Drosophila_2:1640275_at:198:107; Interrogation_Position=1028; Antisense; AGAACCTCGGATCCTGCGTAAACGG
>probe:Drosophila_2:1640275_at:499:587; Interrogation_Position=1055; Antisense; TGGAGCCCAAGTTCCTCTGCTGCAA
>probe:Drosophila_2:1640275_at:302:121; Interrogation_Position=1090; Antisense; AGCGATGGAACTTCGACGTCTTCCT
>probe:Drosophila_2:1640275_at:383:543; Interrogation_Position=1147; Antisense; GGATCGACTTCCTCTGGGTCAACTT
>probe:Drosophila_2:1640275_at:467:309; Interrogation_Position=1277; Antisense; CCACAACCTCTACTGGAACAAGTTC
>probe:Drosophila_2:1640275_at:31:329; Interrogation_Position=775; Antisense; GCGTGCAACCAGTACTACCTGTGCT
>probe:Drosophila_2:1640275_at:310:631; Interrogation_Position=799; Antisense; TCCGCCGGCAACTATCAGCTGATGA
>probe:Drosophila_2:1640275_at:565:625; Interrogation_Position=826; Antisense; TGCCCCTCGGGATACTACTATGATA
>probe:Drosophila_2:1640275_at:10:457; Interrogation_Position=847; Antisense; GATACCATCTCGAAGGCGTGTGTGA
>probe:Drosophila_2:1640275_at:19:283; Interrogation_Position=894; Antisense; CTGCGACAGATGTGTGGGCACCACT
>probe:Drosophila_2:1640275_at:514:565; Interrogation_Position=910; Antisense; GGCACCACTGCGACCTTTGTAAACG
>probe:Drosophila_2:1640275_at:397:721; Interrogation_Position=926; Antisense; TTGTAAACGCCTACTCGGCAACCAA
>probe:Drosophila_2:1640275_at:11:361; Interrogation_Position=943; Antisense; GCAACCAATTGCTCTGATTACCTAT
>probe:Drosophila_2:1640275_at:474:13; Interrogation_Position=959; Antisense; ATTACCTATACTGCGTGAACGGCGT

Paste this into a BLAST search page for me
AGAACCTCGGATCCTGCGTAAACGGTGGAGCCCAAGTTCCTCTGCTGCAAAGCGATGGAACTTCGACGTCTTCCTGGATCGACTTCCTCTGGGTCAACTTCCACAACCTCTACTGGAACAAGTTCGCGTGCAACCAGTACTACCTGTGCTTCCGCCGGCAACTATCAGCTGATGATGCCCCTCGGGATACTACTATGATAGATACCATCTCGAAGGCGTGTGTGACTGCGACAGATGTGTGGGCACCACTGGCACCACTGCGACCTTTGTAAACGTTGTAAACGCCTACTCGGCAACCAAGCAACCAATTGCTCTGATTACCTATATTACCTATACTGCGTGAACGGCGT

Full Affymetrix probeset data:

Annotations for 1640275_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720