FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640278_at:

>probe:Drosophila_2:1640278_at:364:549; Interrogation_Position=1507; Antisense; GGAGGATACGTCCATCACGCAGAAG
>probe:Drosophila_2:1640278_at:176:549; Interrogation_Position=1605; Antisense; GGAGGAACTGCAACACTTCCCACAT
>probe:Drosophila_2:1640278_at:64:717; Interrogation_Position=1621; Antisense; TTCCCACATCCCGAGTAAGTTCTGT
>probe:Drosophila_2:1640278_at:248:493; Interrogation_Position=1635; Antisense; GTAAGTTCTGTCTGTGCCACAAGCA
>probe:Drosophila_2:1640278_at:205:11; Interrogation_Position=1667; Antisense; ATTCCCGAGAGCAACCGAGTGGTGA
>probe:Drosophila_2:1640278_at:496:409; Interrogation_Position=1690; Antisense; GACGAAATCGGCCAGCATTATCATC
>probe:Drosophila_2:1640278_at:87:441; Interrogation_Position=1732; Antisense; GATGGTGGAATACCCCGTTTGCATA
>probe:Drosophila_2:1640278_at:579:131; Interrogation_Position=1756; Antisense; ACCCCTTCAGTTGGACTCGATCGAA
>probe:Drosophila_2:1640278_at:1:45; Interrogation_Position=1775; Antisense; ATCGAAAGTGCCTATTTCGCGGCTC
>probe:Drosophila_2:1640278_at:26:633; Interrogation_Position=1798; Antisense; TCCCCAGAGGGACGATGACTTCTAC
>probe:Drosophila_2:1640278_at:358:133; Interrogation_Position=1929; Antisense; ACGCCTACTTCGAGGGAATGACCCG
>probe:Drosophila_2:1640278_at:340:369; Interrogation_Position=1944; Antisense; GAATGACCCGCAGGCAGGGCAGCAA
>probe:Drosophila_2:1640278_at:703:143; Interrogation_Position=2025; Antisense; ACTGCATCGATAATCCTCTGCTGGA
>probe:Drosophila_2:1640278_at:150:381; Interrogation_Position=2048; Antisense; GAACCGTTCTGTCATTGTGCACTAT

Paste this into a BLAST search page for me
GGAGGATACGTCCATCACGCAGAAGGGAGGAACTGCAACACTTCCCACATTTCCCACATCCCGAGTAAGTTCTGTGTAAGTTCTGTCTGTGCCACAAGCAATTCCCGAGAGCAACCGAGTGGTGAGACGAAATCGGCCAGCATTATCATCGATGGTGGAATACCCCGTTTGCATAACCCCTTCAGTTGGACTCGATCGAAATCGAAAGTGCCTATTTCGCGGCTCTCCCCAGAGGGACGATGACTTCTACACGCCTACTTCGAGGGAATGACCCGGAATGACCCGCAGGCAGGGCAGCAAACTGCATCGATAATCCTCTGCTGGAGAACCGTTCTGTCATTGTGCACTAT

Full Affymetrix probeset data:

Annotations for 1640278_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720