Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640279_at:

>probe:Drosophila_2:1640279_at:63:299; Interrogation_Position=2168; Antisense; CGCTCGTCGAGCTGGAGGACATAGC
>probe:Drosophila_2:1640279_at:228:225; Interrogation_Position=2203; Antisense; AAGGATGAGCCTCGGAGCATACCCA
>probe:Drosophila_2:1640279_at:316:119; Interrogation_Position=2227; Antisense; AGCCCCTTTGAGGTGGACCACAGGC
>probe:Drosophila_2:1640279_at:554:69; Interrogation_Position=2248; Antisense; AGGCATGTGAAACTGGCGACCGATA
>probe:Drosophila_2:1640279_at:640:591; Interrogation_Position=2301; Antisense; TGGTGGTGGCGACATCGATCTCTAC
>probe:Drosophila_2:1640279_at:590:543; Interrogation_Position=2328; Antisense; GGATAAGTCTTCTACCACCGAGGAA
>probe:Drosophila_2:1640279_at:209:295; Interrogation_Position=2346; Antisense; CGAGGAAATGATGGCGTCCGGCTCA
>probe:Drosophila_2:1640279_at:603:503; Interrogation_Position=2361; Antisense; GTCCGGCTCATCCATTCACGAGAAG
>probe:Drosophila_2:1640279_at:9:13; Interrogation_Position=2374; Antisense; ATTCACGAGAAGAGCTCCCTGGTGC
>probe:Drosophila_2:1640279_at:656:305; Interrogation_Position=2391; Antisense; CCTGGTGCCACTGCTGATGTACAGT
>probe:Drosophila_2:1640279_at:439:103; Interrogation_Position=2435; Antisense; AGACGCGCATCCAGAACGGCAGCGA
>probe:Drosophila_2:1640279_at:533:233; Interrogation_Position=2542; Antisense; AATGCCGTATCCACGCTGGAGATCG
>probe:Drosophila_2:1640279_at:479:517; Interrogation_Position=2600; Antisense; GTGTGGATCCCAAGGCCGATGCCAA
>probe:Drosophila_2:1640279_at:266:83; Interrogation_Position=2674; Antisense; AGTGGACTGGACAAATCGTCGGCGA

Paste this into a BLAST search page for me
CGCTCGTCGAGCTGGAGGACATAGCAAGGATGAGCCTCGGAGCATACCCAAGCCCCTTTGAGGTGGACCACAGGCAGGCATGTGAAACTGGCGACCGATATGGTGGTGGCGACATCGATCTCTACGGATAAGTCTTCTACCACCGAGGAACGAGGAAATGATGGCGTCCGGCTCAGTCCGGCTCATCCATTCACGAGAAGATTCACGAGAAGAGCTCCCTGGTGCCCTGGTGCCACTGCTGATGTACAGTAGACGCGCATCCAGAACGGCAGCGAAATGCCGTATCCACGCTGGAGATCGGTGTGGATCCCAAGGCCGATGCCAAAGTGGACTGGACAAATCGTCGGCGA

Full Affymetrix probeset data:

Annotations for 1640279_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime