Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640280_at:

>probe:Drosophila_2:1640280_at:679:303; Interrogation_Position=2523; Antisense; CCGTCTGCGGGAGAGTCTACAAGCT
>probe:Drosophila_2:1640280_at:390:431; Interrogation_Position=2535; Antisense; GAGTCTACAAGCTGAAGTCCTCGCT
>probe:Drosophila_2:1640280_at:314:635; Interrogation_Position=2555; Antisense; TCGCTCCGCAACCATCAGAAGTGGG
>probe:Drosophila_2:1640280_at:460:225; Interrogation_Position=2588; Antisense; AAGGAGCCGCAGTTCCAGTGCCCAT
>probe:Drosophila_2:1640280_at:247:11; Interrogation_Position=2611; Antisense; ATTCTGCGTCTACCGGGCCAAGCAG
>probe:Drosophila_2:1640280_at:587:109; Interrogation_Position=2634; Antisense; AGAAGATGCACATTGGCCGGCACAT
>probe:Drosophila_2:1640280_at:707:727; Interrogation_Position=2646; Antisense; TTGGCCGGCACATGGAACGCATGCA
>probe:Drosophila_2:1640280_at:135:499; Interrogation_Position=2696; Antisense; GTGAAGAACTTTGCCGGATCCAGCG
>probe:Drosophila_2:1640280_at:703:545; Interrogation_Position=2711; Antisense; GGATCCAGCGGCTTAGATGGCGACA
>probe:Drosophila_2:1640280_at:30:85; Interrogation_Position=2738; Antisense; AGTGGAGCCACAGCGACAGCGGCAT
>probe:Drosophila_2:1640280_at:669:119; Interrogation_Position=2755; Antisense; AGCGGCATCCGTGGTAGCAGCTGCA
>probe:Drosophila_2:1640280_at:293:619; Interrogation_Position=2805; Antisense; TGCATCCCCACTTCTCGTAGAGAAA
>probe:Drosophila_2:1640280_at:696:687; Interrogation_Position=2960; Antisense; TATTTAATCACACACCAAGCTCTCG
>probe:Drosophila_2:1640280_at:338:389; Interrogation_Position=2986; Antisense; GAAAACGGAATCAGTGTGCCAAATT

Paste this into a BLAST search page for me
CCGTCTGCGGGAGAGTCTACAAGCTGAGTCTACAAGCTGAAGTCCTCGCTTCGCTCCGCAACCATCAGAAGTGGGAAGGAGCCGCAGTTCCAGTGCCCATATTCTGCGTCTACCGGGCCAAGCAGAGAAGATGCACATTGGCCGGCACATTTGGCCGGCACATGGAACGCATGCAGTGAAGAACTTTGCCGGATCCAGCGGGATCCAGCGGCTTAGATGGCGACAAGTGGAGCCACAGCGACAGCGGCATAGCGGCATCCGTGGTAGCAGCTGCATGCATCCCCACTTCTCGTAGAGAAATATTTAATCACACACCAAGCTCTCGGAAAACGGAATCAGTGTGCCAAATT

Full Affymetrix probeset data:

Annotations for 1640280_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime