FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640282_at:

>probe:Drosophila_2:1640282_at:446:453; Interrogation_Position=1017; Antisense; GATCATAGCTACCAACGGCGGAGCA
>probe:Drosophila_2:1640282_at:319:551; Interrogation_Position=1057; Antisense; GGAGAGATCGATCCCGCTCCAGAGA
>probe:Drosophila_2:1640282_at:277:45; Interrogation_Position=1081; Antisense; ATCGCTCGCGATCGCTTAGCAGAGA
>probe:Drosophila_2:1640282_at:112:69; Interrogation_Position=580; Antisense; ATGGCCTCATGATGAAGCGATCGGC
>probe:Drosophila_2:1640282_at:308:293; Interrogation_Position=597; Antisense; CGATCGGCACAGGAGCTGCAGAGCA
>probe:Drosophila_2:1640282_at:585:419; Interrogation_Position=617; Antisense; GAGCATAAGGGCCATTCAACAGCAA
>probe:Drosophila_2:1640282_at:470:421; Interrogation_Position=666; Antisense; GAGAAGGACGCTCATGCCGATGACC
>probe:Drosophila_2:1640282_at:115:317; Interrogation_Position=681; Antisense; GCCGATGACCAAAATCCCGAACTAG
>probe:Drosophila_2:1640282_at:70:679; Interrogation_Position=703; Antisense; TAGTTTTTCTCAAATCCCTGTCCAA
>probe:Drosophila_2:1640282_at:553:123; Interrogation_Position=778; Antisense; AGCGCAAAGGCGAGGGCATCAAGAA
>probe:Drosophila_2:1640282_at:687:475; Interrogation_Position=903; Antisense; GTTAGCAATAGCTCAGACTCCTCTT
>probe:Drosophila_2:1640282_at:404:645; Interrogation_Position=924; Antisense; TCTTCATCGTCGGACAGCAGCGACT
>probe:Drosophila_2:1640282_at:265:263; Interrogation_Position=941; Antisense; CAGCGACTCCGAGGACAATCACAAA
>probe:Drosophila_2:1640282_at:393:255; Interrogation_Position=999; Antisense; CAAAGGACTAGGGACTCGGATCATA

Paste this into a BLAST search page for me
GATCATAGCTACCAACGGCGGAGCAGGAGAGATCGATCCCGCTCCAGAGAATCGCTCGCGATCGCTTAGCAGAGAATGGCCTCATGATGAAGCGATCGGCCGATCGGCACAGGAGCTGCAGAGCAGAGCATAAGGGCCATTCAACAGCAAGAGAAGGACGCTCATGCCGATGACCGCCGATGACCAAAATCCCGAACTAGTAGTTTTTCTCAAATCCCTGTCCAAAGCGCAAAGGCGAGGGCATCAAGAAGTTAGCAATAGCTCAGACTCCTCTTTCTTCATCGTCGGACAGCAGCGACTCAGCGACTCCGAGGACAATCACAAACAAAGGACTAGGGACTCGGATCATA

Full Affymetrix probeset data:

Annotations for 1640282_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720